Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPF1
Systematic Name YEL031W
Alias COD1, PER9, PIO1
Strain S288c
Description P-type ATPase, ion transporter of the ER membrane; required to maintain normal lipid and sterol composition of intracellular compartments and proper targeting of mitochondrial outer membrane tail-anchored proteins; involved in ER function and Ca2+ homeostasis; required for regulating Hmg2p degradation; confers sensitivity to a killer toxin (SMKT) produced by Pichia farinosa KK1; null mutation is complemented by human Parkinson disease-related ATP13A1
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPF1 YEL031W
ACCAGCAAGCAACTCTGGATCCCCAATCAAATCTACTCCAAGAAGGTCAACGGCATCTTC
CGTTAATGCCACGCCATCGTCAGCACGCAGAATATTACGTTTTCAAGATGACGAACAGAA
CGCTGGTGAAGACGATAACGATATAATGTCACCGCTTCCTGCGGATGAGGAAGCTGAATT
ACAAAGAAGGCTTCAACTGGGGTTGAGAGTGTCTCCAAGACGTAGAGAACATCTTCACGC
ACCTGAGGAAGGTTCGTCGGGACCTCTTACCGAGGTCGGTACTCCAAGATTACCTAACGT
ATCTTCTGCAGGTCAGGATGATGAGCAACAACAGTCAGTTATTTCTTTTGACAATGTGGA
GCCTGGTACCATTTCTACTGGTAGATTGTCTTTAATCTCAGGTATTATTGCGCGTCTGAT
GCAAACAGAAATATTTGAAGAAGAATCCTATCCTGTGGCCTCTTTGTTCGAAAGAATCAA
CGAAGAACTACCGGAGGAGGAAAAATTCTCCGCTCAAGAATATTTAGCAGGTTTGAAGAT
CATGTCGGACAGAAATAACTTAATGGTTGCTGACGATAAAGTTTGGAGAGTCTGATGTCA
CAGGAATGTTTACTAAAAGACTTCCATTCTTGGCTTTTTTTCTTTTTGTCATTCATAATT
TTCAGTTCATTTCCAGATTATTTAGTTCATTAATTGTTATTCGTGTATTAAAGAATTATG
TATTAAAACGCTTATTTCCTTCTTTTGTTTGAATGTGTTGTAAGCAGTTATGGGGCACTA
TATCTTCTGTTAATGAATATGTGTGATACTTTGGCTTATCTTACTTGCTCATTCGTGGCT
TCTTGTCACGCCATACGTTACGCGTTTCTCTTCCTCTTCGCGTGTTCTGAATAAAGCCAA
GTGGCAATGTCTCTTCCACCATATAACATGAAGCTTTAGCAAGCTTTTAGCTCTAGACAT
AGTTGACATATCAGACCTACAGAAACATAGGAATCGGTAA
Chr coordinates Chr V from 90258-93905
w3c xhtml validator w3c css validator