Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HOM3
Systematic Name YER052C
Alias BOR1, SIL4, THR3
Strain S288c
Description Aspartate kinase (L-aspartate 4-P-transferase); cytoplasmic enzyme that catalyzes the first step in the common pathway for methionine and threonine biosynthesis; expression regulated by Gcn4p and the general control of amino acid synthesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HOM3 YER052C
GTCTCACATCCTGCAGACGTTATGGTTTCCAAGATCAATAGCGAAAGAAAGGCCAACGAG
TCCATGTCTGTAGCCTCTAAAAGAATATATCAAAAAATTGGCTTTACTGGGTTGTGGAAT
GGGTTAATGGTGAGAATTGTCATGATCGGTACTTTGACAAGTTTCCAATGGCTAATTTAC
GATTCGTTCAAGGCTTATGTAGGCTTACCAACCACCGGTTAGCTGATCGATTCAATCGGC
AAGGTTTATCGTAAACACTCTGTGCTAGAGGAATATTGTATACACAGGATTTCATAAAGT
TAGTAAATGACCGGCATTTATAGTTTGTTCTTCTTTGCATATGTCTTAATAAATATTCGT
CCTACAATTTCTTTTCATACTAAGAGTTTTGTTATGATTGCCAAATTTCTCAAGCCAAGA
ACAGGCCCAGGAAAACTTTGAAAGTGCCATATCAGAAACACATTTATAAGGTAGTTTCGA
TATACGGCAATACTCGATGCATGCCCAAACTTGCCAGCCGCTCGCGATTGAATCTTCTAC
AATTTTTAGGTGAACATATTCAGAGGCTGAGGCCTTATTTGATAGTAACATCAAATATCA
CTCCCACAATTTACAATCACTGTCATTGGTCTCACAGGATCCTTTTCTTTCTAGAACTCC
CCTAATATCAACTTTTTACTCTACTGTGGCTCTAACCACGTGTATTTTTCAGGCCCATGA
CTCACCTTTTCTTTCTTTTTCACTAGCAAACGAAAATTTCATCATCACTTTTTTTTTTTT
TCACTTTCCGTACGCAGTCTTCTCCAGAGATTCTTTTAGCTTCGAAGAAATAATGTATAA
TATCCATATATAAGAATACTGCTGGATAATTATTTTATTTCTATTTTAACAGTGCTCTAC
TCATTGAAGGATATTTGTGTAGCCAATACTCTCTCCATCGCTTAAGCTCACATAGCTATC
GCATTTTATCACAGAAGCTTTCATTTTTTTTAACTTTTAC
Chr coordinates Chr V from 257958-256375
w3c xhtml validator w3c css validator