Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PIC2
Systematic Name YER053C
Strain S288c
Description Mitochondrial phosphate carrier, imports inorganic phosphate into mitochondria; functionally redundant with Mir1p but less abundant than Mir1p under normal conditions; expression is induced at high temperature
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PIC2 YER053C
CGTAATTATGTATTTTTGCTATTGTATATGATATACGTCTATATTTAGGCAATTATAATA
TGATTATAATATAACTTACTACATCTCTAAAACATGCTGTCTAGCCCTTCCATCGCAAGA
CTCGGCTAGACATTCGAGGAAGGCACAAAAAGCCACCTATCCCCATCTCTCCAAAAAGCT
TCATTTCGAAAATAAGAAGGGAAACATCCGAATAAGACTAAAACTTTGTTCCTTCAATGA
CTACTAAGTTATTAGATGTCAGAAATCCCGCAAAATCGCCCGCATATCAAGGTAAGCGGC
AAAACCCTATTCTTGAAAAAATGTAAATACTAACCGTGTGAGAATTTTAACGGTGTATTC
CAAAAAGTCAGCACGTGATCTGCTAAGAAATCCGAACCTCGGCCTTTGTTTTTTTTGTTA
CAGCATAGGGAAAAGACGCATTGTGTCAAAAAGGAACATCGTACCATTACCCTCTCAGCA
CATAGGTAATAAGGTGACAAGTAGCAAGTGAAAAGTACCGCTTACGAAGAATACTTTAAT
TCAACGTAGATACTGCAAAATATTCAAGTCATTATTTTTGGCCCTTAACTTGCCTTTCCA
GTTCTTAGATTCATTCATATGCTAGCTAGCAACAACGGTCACTTTGGGTTGCATTTCACA
ATCTCATTCGGCTAAGATCTCGGCTAACCAAAAGTTGGACTTCAGGGGTATTAGCGAAAT
AAGGAGATCTTTTTTAGGTTTATTCCTTGTTTTTAGTTTCATTTTGCTTAATAAAAAGGA
AAATGGATATATCGATTTTCTGCATACCCTGTTACATTTGATATAAATACAGCGGGACCT
ACCAAATATACTTTCATTTTGCTTGTGTTTTATAGATATTTTATTTTTTTTTCCAGGCAG
TCAATGACACATTGTTAACTGAAAGTGTTCTGTTATTGTTTTAATTCTAAAAAAATAAAG
TAAGGGAAAAAGAGAACGGACTCATTGACAGTTGTAAAGC
Chr coordinates Chr V from 259639-258737
w3c xhtml validator w3c css validator