Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER053C-A
Systematic Name YER053C-A
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER053C-A YER053C-A
ACCAGAAGGAAGGAGATGAAGAATGGACATAAAAAGCAAAATGACTTGCTAGATCTTGGC
CTGAGTTACTCTCATGATTGGGACCGAACTCCGATAAATAACTCTAAAACATGCTAGAAT
ATTTCAAGTAAATATACATAAATCACAAATAAGCAAATAAACAGATAAATATCTCACAAG
AAATCGGGAGCCGATCTTCGATGTGTGTGGGCGTATATACAAATGTGCATTCGGCACGTA
AAAGACTGGTAAAGGCTACCGTCCTTCAGTGAGCATTTTTTACATTCATTCAACGCTATA
CAGCTCTTACTGTGCGACGGAAACGCGACAAAATGTGAAGAGAAAACTAGGGGTTGCTAT
GACACGACCACGGAAGGCCTAAAAAGTTAAGTGACAGAAATCGTCATTGGTAAAAAAAAC
CCCGAACATGCCGATAAAGACTTGCTTATTCACCTACGATGACTTCAGAAGTGCGCCTAT
ATTTCTTTACTTTTGAACACCCTTCCACCGCCCATTTAGAGAGAGCTATTTTTGTGCCTT
CACTTCCGGCAGAGGTTATATTTTTTTTTTTTTTTTTTTTTTGCATACTACTCCTACTTC
TTTCTACAGTCTCATCCCGACGCTTCAGTTTGAAATGTAAGGGACTGCGGCATTTGACTG
AAAGAAGGGAGAATGGATGGTTTACTTTACTTTTTACGTAATGAAAAAAAAAATGATTGC
TGTATTAGGACATCCCTGTTCTTTTATGTGGTAGCCTATATCCGATAACTGTTCAGCTAT
AAGACGTGAAGAGAGATTTTTTGGTACCCCTTATGCATTCAATTAAATAGAGAATTAGAT
ATTTCTACCGATGTGCATTTTGTATATAAAGAAGTAGGAATCCCTTCTACAACGACAGAG
GTAGACATACTGCTTGGAAACATTCTTTTCGTCCTTTTACAGAATTCTACATAGAAATAA
TAAAAACAAACAATAGCTTTACTACACAGTACACACTACA
Chr coordinates Chr V from 261046-260933
w3c xhtml validator w3c css validator