Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPP2
Systematic Name YER062C
Alias GPP2, HOR2
Strain S288c
Description One of two redundant DL-glycerol-3-phosphatases (RHR2/GPP1 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPP2 YER062C
CAATTCTAGTGGTGAAAAAAATTCTATTCAATATACAGATATCTTTGTAACTTCTGAAAG
TAGCGCATCCTGAAAGGACACATTTGAAGAGTCACTATTCAACTTTCTTCTCCCATTCAG
CATTATCACGCCCTTCCACCAACGCTGGTTGCATTGTGTTTTCTTACTTCGGCTAGAGAC
GCCGGGTAATAAAATATATATCCTCGAATGAACCGCTGGCCTCGGCCATTTTCATATGAC
TTCATATCATTAATATGGCCGTAGGTTAAGCAATGCTACGTGAAAGATACCAATTCCAAT
CGTCTGCTTTCTCTCAAGAGGAGACTTTGCGTTCTTTAAAGGAGCAGAGAAAGAGGGAAA
CGGTGAAAAACTTCAATATTGATAACATCCATCAGCGTCTAAATTCCTATGCCTCCTTCG
AAAATGGTCAATGTTATACCCTCTCCCATTAGATATTACCGTAGCGTACGTATTTGGCCC
TGTCCTTTGGGGTTTGGCCTTCTCAAGTATTTTGGCACCTCGCCCTGAACGAAAAGCTGG
CACTTTGTCCCCAGCCAAACTCTTCTCTCTAATATCGTCTTTAACGACAAGGTAAAAAGA
TTTCTGCAGTGTTCCGTCTGCGTCATCATCTGTGCCCCACAATCCGCGGCGTTTCCGTGT
AAGCCGTCAAGTGAGGACTTTTCGGATGCTGAAAGAAAGTACGCTCGGAAAAACTACATA
GCTGCCCCCCTAAACGGGCCTCCCACGTGACGTAAAGTAGGAATAATAAGAAGCCAAGTC
GTTTCTTTTTATTCTAAATAAGTTCGTTTCTTTTGATGTTGTCATTTTCAGAAATATATA
TATATGCGCTTAAATACACAAGCTAAAACAACATAGTTAGGATTGCCAAAGGTTTCTTTT
CTACTCAATTTGGTCTAACTCTTTTCATATTAATAGCGCCAACCAGCTAGTGTTTACCAG
ATCAGTGGAAAAACATAAAACAATAAAAACAATATTCGGA
Chr coordinates Chr V from 280682-279930
w3c xhtml validator w3c css validator