Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ICL1
Systematic Name YER065C
Strain S288c
Description Isocitrate lyase, catalyzes the formation of succinate and glyoxylate from isocitrate, a key reaction of the glyoxylate cycle; expression of ICL1 is induced by growth on ethanol and repressed by growth on glucose
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ICL1 YER065C
TGGAAATGTAAAGGATAATGAGTGAGCATATAAAATGGAAGAAAAAATAATAATAGGATT
ATGTATAAAATATCGATTCCCTTTTGTAGATTTCGAGATCTTCGAGGAGAACTTCTAGCA
CGTTGTTTACATATCTAATGTTGTAACACGGCCTTTGTTATCTTGTGAATATATCCATCA
CCTACGTCGCTTGAGGTTTCGTATCAAAGAAAGAGAGTTCAAACATAATCATACGTGTTT
CACTCCAAATTTGATCACAAATGGCCACCCATTATAGCTTGTTATTATTTACTTCTTCTT
GAGTTCATTTTATTGAAAGATGCCCGCTGGGAACAAAACATAAATAAAATTCAAGAGTAC
AATATAGCGTAGCATAGTTGCGAGCAAGGGAAGGCAACACAGTTAAAATGACAATGTTAG
AAGGAAAAACTAAATCAAGCTCCCATAGGAAATTTCTTGTGTCAGTAATATGTCTCGAGA
AAATAATAATAATTGAATCTATTTATTGAAAAGTAAATATCTCGTAACCCGGATGCTTTG
GGCGGTCGGGTTTTGCTACTCGTCATCCGATGAGAAAAACTGTTCCCTTTTGCCCCAGGT
TTCCATTCATCCGAGCGATCACTTATCTGACTTCGTCACTTTTTCATTTCATCCGAAACA
ATCAAAACTGAAGCCAATCACCACAAAATTAACACTCAACGTCATCTTTCACTACCCTTT
ACAGAAGAAAATATCCATAGTCCGGACTAGCATCCCAGTATGTGACTCAATATTGGTGCA
AAAGAGAAAAGCATAAGTCAGTCCAAAGTCCGCCCTTAACCAGGCACATCGGAATTCACA
AAACGTTTCTTTATTATATAAAGGAGCTGCTTCACTGGCAAAATTCTTATTATTTGTCTT
GGCTTGCTAATTTCATCTTATCCTTTTTTTCTTTTCACACCCAAATACCTAACAATTGAG
AGAAAACTCTTAGCATAACATAACAAAAAGTCAACGAAAA
Chr coordinates Chr V from 286914-285241
w3c xhtml validator w3c css validator