Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RGI1
Systematic Name YER067W
Strain S288c
Description Protein involved in energy metabolism under respiratory conditions; abundance is increased upon intracellular iron depletion or in response to DNA replication stress; suppresses pro-apoptotic effect of expressing human BAX in yeast cells; RGI1 has a paralog, RGI2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGI1 YER067W
TTCATGCATTGGGCCATGCAGTAATTATCACACTCACTTTGTCATAATGTATACAATGGC
CGCTTATTTGCGACTCGTCTCATATTTTTCCTGAAACTGTAGCTGTGTGTAATATTATTC
ATTAACTTCGATAATTCGGCTACAGAAGACAAGAGCTACATCCTTACTGGTGCGAATAAA
TGACATAATCTGTCAAGAGTACCGAAGTAAAAGCAACGATTGCCGAACACATCTTCCTGA
AGTATCATATGCCAATACAAGGTTTCAATAGGAATTATGAAAGCGGCATTATCACCCTTA
ATCTGAAATATGTAATGATGACGGTGCAGTATGTTGACTACATTGTAAAGTTGCACTTTC
ACTCAACTCATGAAATTGATGACATTAATCCTACGTGACTTACACATATGCCATGAACGA
AGAAGGTGGCACCAAAAATCCAGCGTTTCCGATATACACGCAGTCAAATGTTCAGACTAA
ACTTTGGTATTCTGACAACGTGTTGTCATACCTGTTACGAGCCAGAAACGTATTTCTTTT
TGGGTGATACAATCTCCAGATGACTGCTTTTTTTTTTTTTACCCCAGATTCAGGGGCCGA
AGGAACGGAAATGCGGTGTGGCGAGATTGCGGATGTGCTAAAAAATAATATCCTCGAGGC
AACCAGCATAATGTGGACGGCTCTCGGCAATTGACTTCCATAACAAATGCATCCTGTAAT
CAGGGGTATTATAAGTTACTGTATGGTTAATTAAATATAGAATGAAAGGGGCAGCGTTCT
TAAGGGGTATTGCTGGGTGGAAAAATACAAGTGTCTTTACTTGATTGTGTGCACATATAT
AAGGCAAAAGATTTCTAGCGTATATTTGAATCTTTTGTTCTTCCACGTTCAAATTTCTTT
GGTCAAAACATTTCATAAAGGGACAAGTTCTGCATTGTATTCTAATAATTGCCCATAGAA
CATATAAATTAGGTATCGACTGTTTTCGTCTCCACTTTAA
Chr coordinates Chr V from 292066-292551
w3c xhtml validator w3c css validator