Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARG5,6
Systematic Name YER069W
Alias argB, argC
Strain S288c
Description Protein that is processed in the mitochondrion to yield acetylglutamate kinase and N-acetyl-gamma-glutamyl-phosphate reductase, which catalyze the 2nd and 3rd steps in arginine biosynthesis; enzymes form a complex with Arg2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARG5,6 YER069W
AAGAAACTTATAAAAAGTATCCGTCTTTGTTTTCTTGGGACAAGATTGAGGCCTCAAAGA
AAAGTGACAATACATTAGCCAACAAACTTGTGGAGATCCTGGCTATAAAGCCAATAGACT
ACACTGCTTCTGTCGTTCAATTCTTGCAGAGTGTCAATGTTGGTGTAAATGACAATATTA
CAATCACAGATAATACGAAAACTCCCACCCAACCAATAAGACTGCAAACCGTCTCACAGC
AAATCCAACCACCATTAAACGTCAGTACCCCTCCACCGGGTATCTTTGGTCCACAACATA
AGGTTCCTATTCAGCAGCAACAAATGGGTGATACAAGCTCAAGAAATTCCTCTGATTTAC
TAAATCAACTAATCAACGGAAGGAAAATTATCGCCGGTAATTAATCCGACTCTAAATATT
TTTCTTGTTTGCATTAACCATAATTTTATCTATTTTTATTTCTCATGAATATATAATCTC
TCCGTTTATAACGAAATGCAAGAAAAAAAAATCTCACCCATTTTTTTAAACCTTTGACGT
GGAAAGGTATCTGGGAAAGGTATCTGGCTAATGAATAATGCCATAGCATATACCAGTATA
GTCTATTTACTCGTTACAACGTATGAAAGCGTCAGCGCTGCAAGAATGACTAATTCATAG
AAAATAATCATCATGATATATATCATAATGCACGGAACCTGCTTCGCTAATTTTTTCACT
TAAATCACATTTTTTCAACGAAATCTCTTGCGCAGTTGGTTGGAATTCTTATCCGAATGA
CTCAGTCTACATCAAAAAACTGTGGCCGAATGGTGGTAATTGATGACTCTTCTATTTTTT
TTTTTCATATAAAGAGCTTGCGCGCGTGTTGTTGTTCGCTATCCATTTCCATTAGGAACA
TTTTTGGATATTATTTTTCAGACCCGTAATATACTTAACACATATACCACTAAAGGCAAA
AGAAAGAGAGATCTGAAGTGAGAAATAAGTCTGCATCATT
Chr coordinates Chr V from 295410-298001
w3c xhtml validator w3c css validator