Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNR1
Systematic Name YER070W
Alias CRT7, RIR1, SDS12
Strain S288c
Description Major isoform of the large subunit of ribonucleotide-diphosphate reductase; the RNR complex catalyzes rate-limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNR1 YER070W
GGGTTATGGAGAGTATGCTGGTATCCCTGAAAATAAAATTATTGGTGTCTGATCACTGTG
TATAGTAGATCTGCAGCTCAGTCACATGAGACATTAACGTATATAAATATATAAATATAT
ATATATCCATTAAATAACGAAGTAGGACATGGTCTAAAAATAGTGCTTCTCATGTATTGA
TTTTGAGTAGCCATAAGAATAATTATTGATTTCAAGATCTTTGATCTCCTTACATCCAAA
ATTATAATACCACTTTATGGTATCACGACATCACCACAACAGAGAAGGATTGCCGCATTT
GGATATCGTAAACAAAGGCGTTACCATAGAAATGTACTGATTGGCAGAATTACTCTTCAG
GAGAATCTTTCATACAAAGGAATTCCATTGGGGAAAATCTCGTTACCAAGTCAATGCTGA
ACTTTCTATGGCCTTTGTTTACTATCGTTAATTATTTTACGACCACTTCTGGGTAGAAAT
ATTTCGTAGCCCTGGAACGAGCTTGTTTACGCGTTTTATCCCATTATATGGCACCCAAAT
CAAATTTAAAAAGAAAAAACGCGTAAACAGTGTCGGGTAAGTTCATCCTCTGTTACTTTA
ATTGCTTCTTTTTTTGAAATTCTAAGTAAACGCGTCATTTTGATCCTCAGGACACAGAAA
TCCTTGCAGAATCTTATTGGGTGTTGAATAGAGGACGCGTAAAAACGATATGGAAATTTT
TTTCATATAGTGTAGAAAGAATAGGTTGGCGTAGGTAGTTTCGTGTTTGATAGAAACCTC
CAACAAAGTCTGCAGCTCACGTTTTAGAATAACAAGTTTAGAGTTTATCTTGTTGCCTTT
GTTAAGTCAGTACCATTGAATAAAAATTATATAAAGGAGCTAATATTTCATTGTTGGAAA
ATTACTCTACCATAATTGAAGCATATCTCATCCTTTTCATCCTTTTCAACGCAAGAGAGA
CACCAACGAACAACACTTTATTTGTTGATATATTAACATC
Chr coordinates Chr V from 298950-301616
w3c xhtml validator w3c css validator