Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ALD5
Systematic Name YER073W
Strain S288c
Description Mitochondrial aldehyde dehydrogenase, involved in regulation or biosynthesis of electron transport chain components and acetate formation; activated by K+; utilizes NADP+ as the preferred coenzyme; constitutively expressed
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ALD5 YER073W
CGCGCTTGTAACATACCACTGGAGAGCTGCTGCGATTAGACGTAGAGGATCAGGTCCTTA
TGATGACAGATTGGGGCCCACTTTGTTGTGCTTTTTCTTATTGGTTGCTGTCATTATCAA
CTTTATATTAAGATTGAAGTACAATGACGCTAACACTAAGTTATGAAATTGTAATTCCAA
TATCGTAAGCGTGGGTTACGCACAAACTGTATTTTCAAGATGCTCACAAATAATTTAGTT
TCATATATACGCATATATAGAAAGTATCCATCTATAGGTAATCATGAACAATAAAAATAT
TCACGTTTCAGGAGCTATTGTTTGTACTCATTACGTTTTTGGATATCAAGTTGAAAATCA
GCCCCTTTCACTAGATATCAAGCGCTATAAAAAAATTTTAATTTCGATGAGGCATCTTTC
TTTTCTCTTGTGGCTATGTAAGCCTAAGAAGCCGTTTACACATCAATGATAAATAAGTAT
ACAAAAAGGGTTCCATTTTTTTTTTTGGCCGCTACCGGACTAGCAAGGGCCTAATGGTAC
GCTGAGCGTAGTACAACCAAGCGCTTGTTAGCCGTAGAGTTAAGCTCTTGACTACTATTA
CGGTAAAAGCCGGGAACGTGCGTAACAATTTTTTTTTGCATTAGGTTAAAGAGGCTCGCT
CGCGGAGCCTTTAGAATACCGCTTAAGGCGCCAAAAGATGGAAGCTATTCTCTTTCTTTT
TTTTTTCACAAACTGAGAGGGGTTGTGTATCGTTAAAAATGTTGGAAGACTTCTGACTCA
TCACTACGCAGATTGTTAGAGTTTTTCGATGAGAATGGCTTCAAAGAACAGAACAAAACA
CGATTATATAAGCCCCATGTAAAAAGAACGTCTTAATTTATTTTGAATTTAGGACTTCTT
GACATTTTTAGCATATATAACAATACGATAAGTGTCTCATCAAACGTGGTTAAGACAGAA
AACTTCTTCACAACATTAACAAAAAGCCAAAGAAGAAGAA
Chr coordinates Chr V from 304030-305592
w3c xhtml validator w3c css validator