Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER079W
Systematic Name YER079W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YER079W YER079W
ATGCCTGATTCATCACATTCAATAAGCTCAAAAGATGTTGCATCTGCCATCTCTCTCTAT
GATCAGTCCATTTACACTAATAACAGGTCTACTAACCTGGACTTAGATCAGAGATCAATG
AGCCCTTCCAATATTGCCTCTGGTGAAGATAGGATAACGAGAACGAACTCAGGTTGCTCC
ATCACATCAGGTGCCTCCATGATTGCCACGAAGGATGGTATTCAGGGGATTAATGTCAAA
AGAGATGGGATTCCGAAATATTCACTTAATTTATTGAATTCCATGGTTCGAAAACAATAT
GATCACAATAATGGAACAAAGTCTCCTACCCCGAAGACTAGCAATATGGTAGACCCTAAG
AACAAAAAGAAGAACAAAAAAAAGAAGAATGACAAGGATGACAAATACAAGGTATCGCAT
GATCAAACCGAAAAGTTTTACAAACTCAACACCACTTCCAACTCCAATCTCACCTCTGAT
TCTACTACTTCGTTATCGGACCAGTTTTATTTCCAGAAAAGTAACGCTGATTCTGCTCCA
TTAGACAATGCAAATTACCCACTCTCCGACCATTCCCCCTCCCTAAACTCTATGGATAAT
ACTACAAAGCATAGCAGCAATGTGCACACTTGA
Promoter Sequence
Download FASTA
>YER079W YER079W
CAGCATGTGGAAAATTGTATCACTTAAACTATCCGTTGGCTTTTCTAAAATCATGACCGA
ATTAGGTTCATTCCAACCACTAAGATAAAACAGGTCATTTTCCTGTTGGAACGGATAAAA
TACTGCTCCAGATGCAAATTGGATATCGTTACCAGCTAAAATCACACAACTTTTGGGAGG
CAATGTTTCCGCCAACCTAATTCTTCTTTCATAGTATTCCAAGGCTGAAATGCCTGGTGT
CAACTCGCCCGACTTTATAAGGAACGGCCTTGTCTCATGCAGTGGTTGGCCTGCCTCAAT
GGGGATTCTGACTCTATTAGTAAAAGTATTACTTTTATGCTGTTCCAATGGCGATACCAA
CTTCGAGAAGTATCTTTGGCAAGATTGCATAGAAAACCGTACTGGGTTTATCCTATGTAA
CATATCAACAGAAAATGACCACTTTTCCTATTAGCTTTTTCTATTATATTCTTTAGAATT
GGTGGAGTTTCTTGCGCAAACGATCCACTTTTGCAGTGCAGTAAGTGATCCCTATACCAG
GTGAGTTGATATATATTTACTGTATCTTGTACTATTTTATGAACAAGAAAGGCTATTACT
CACAACAGTTTTGGTTTCAGTCAAAGTTTATGTGTGAGTGTGAGTGTGAATGTGTGCGTG
TTGCATAATTGCATTTGGCCTTTCCGAGAAATAAGTCATTCTTTATTTTTCTCTCTTTAC
GGTTTAATGGTGCGGCTTTCGTATCTGCGTCTCATCCTTCCCCCTTGCCGCTTGTCAGAA
CTCTCTAGCTTGGCGATTCTCTATCAACCTGTTATTCCAATTCTTATATCTACCATTACC
TTCCAGCATTTTTTCAAATGTGTTCACACGCCCTGTAACGTTTATATATAAATATTTTAA
TATTTAACTTAGCTTATGCATATATAGTTAAAAGGGATAATAACAATAAGAATAAAAAAC
ACAAACTGCTGAGATAAGAAAAGGAAGCGAATAGTTAATA
Chr coordinates Chr V from 318920-319552
w3c xhtml validator w3c css validator