Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IES5
Systematic Name YER092W
Strain S288c
Description Protein that associates with the INO80 chromatin remodeling complex under low-salt conditions
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IES5 YER092W
CCTTTCTTTGTAAACCTCTACCCATAGCAAACAAAGTGTCGATTGGAGATAGATCGTACT
TAGTGTAACGGTCTGGAATGACATTGAACAACAAAGACAAATCCAAAACTTGGTCGTAAA
AGGAGAAGTCATTGGATGGGATGATATCAACACCAGCCTCCTTTTGCAACTTCCAGTTTT
GAGTTCTCAAATCCTTACCGACCTTGAATAATTCATCGACAGTGATTTTACCGTTCCAGT
AACCTTCAGTGGCCTTCTTTAATTCTCTGTTTGGACCGATTCTTGGGAACCCTAAGACAG
CAGATTGAACCATTTTTGATATGTACTTTGAAATTATATTGGTATTTTGTTTCTTAGAGT
GTTGTCAATGCTCTTAGATGCTTGCTTTTTTATGATAAAGGAAGAGTTTAACAAAAATAT
TGAATACGTAAAAGAGAAACTAATGCTAGTAAAGATGGAAATATCTATCACTTATATAGA
ATTTTTTTTTCTTTCCTTTTTTTCTTTCGCAGTTGGGAAAACTAGCTAGCTTCCCTTAAA
TTAGTGCATCTATCGCATTTGTTCCATATTCACATTCACAGTTCTCAATTGAGCAGAACG
AGCTATGACTACCACAGTTTTGCGACCGGGAGATAGAGCGAAAGAGCTGCCATGACTGCG
ATGACTCTAGCGAAAAATATTGGCCTTTTGCACGTTCGCGACTAAACGAGTTCGATAGTA
GTCCCGTTTCTGGTTTTTTCCCTTTACCGGCCCACATTTTTTCACCTGACTCCGGTCCTG
ACGTACGACTCTGTTTGTAAGTCACGTGAAATATTTCCTGTGGCTTTTACTAGTAATGTG
CACGTGATGTGGCGTGATGGTCCTTTACCCGGAGTGCGGGACCCTGGTTCATGAAAAATT
GTGTGAAATCAACTGCATTTTTGGAAGCGAAAAAGATGATGAACCTGAGTTGAATGGCTG
TGGGAAACCAATACTTGACTGATTATAAAACAAGAAAAAA
Chr coordinates Chr V from 342855-343232
w3c xhtml validator w3c css validator