Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UBC6
Systematic Name YER100W
Alias DOA2
Strain S288c
Description Ubiquitin-conjugating enzyme involved in ERAD; located at the cytosolic side of the ER membrane; tail region contains a transmembrane segment at the C-terminus; substrate of the ubiquitin-proteasome pathway; ER-associated protein degradation is also known as ERAD
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UBC6 YER100W
TTATTGAAATCTGTTTTGGTCCTTATGTAATTCAACACACTTGGTTCACCGTATAAATTA
TCAACCGGGATATGAAAAAACCCTTGAATTTGTGAAGCATGGAGATCCATAGTAATAACA
TGATCACAACCCGCAGTTTCCAAAAGATTGGCAATCAGCTTCGCAGTGATGGGCGCCCGC
GATTTATCCTTCTTATCTTGTCTAGCATAAGGGAAATTTGGTATTACTGCCGTAATTCTT
CTGACTGATGCCGTCTTACAAGCGTGAATTAAGATAAGTAATTCCATTAAGAAATCGTTG
ATTTCATGTTCCCCGTAACCAGTTTGGATGATATATACGTCTTCATCACGAATGCTTTCC
CCTATTGTAACAGACGTCTCTTTATTTGAATACTGATATACCCCCACTTTAGATAACGGT
ACACCAAGCCTTTGGGAAATAAGCTCAGCAAGCCCAGGATGTGAGTTACCAGCTAACAAC
TTAATACTGTTTGTAGACATATTCAACGAAACTTACGACAAGATAGTCTTTGGATGATGA
GGAATATCCTCTTCTTAGCAATCCCTCGATGCCTCCTCATATCATCTATTGTTCAAAATT
TTTTCATTGTTGAAAAATAGTCACGTGCTTAACCATTTTGCTGCGCGATTTGGTAGGAGG
ATAAATACACGGGCATACCGTATCTGTTCAATAGCAACAATGTCGGAGAGAGCTAAACTA
GCCAACTCGCCATCCTATTCCACTGGTCGCTTGAGTCGATATCCTTCCACAGCAATATTG
CACTTTACAATTAGGATAGCCTCCCCAATAAAATAAGGAAATTTTGGTTATTTGTGTTCA
GAAAAAGCCGAAATCGATTGCAGAGAACAGAAAGGAACTTTCCGATTATCACACTTTAGG
AGCCGTGATAAAGAAGACTACCATCGCATATCGCAGAAAAGACTTTAAATATTAACTAAA
ACCGCATTCGCAAATTGCAAACAAAGTACGTACAATAGTA
Chr coordinates Chr V from 359562-360314
w3c xhtml validator w3c css validator