Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SSA4
Systematic Name YER103W
Alias YG107
Strain S288c
Description Heat shock protein that is highly induced upon stress; plays a role in SRP-dependent cotranslational protein-membrane targeting and translocation; member of the HSP70 family; cytoplasmic protein that concentrates in nuclei upon starvation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSA4 YER103W
AGATTATACGCTTGTATCTCTTCCAGACCAGGTCAATCCGGTAGATGTGATGGTTACATC
TTGGAAGGTGAAGAATTAGCTTTCTACCTAAGAAGATTGACTGCTAAGAAATAGAGATAA
TAAGATAATATTTTATTACACTACATGTACAATTTTACTTTTACTTTGTGTTGTCTCTAT
CTGCTTTCTTATTTTTAATATTTACCATTCCATTTATAATTTGTAAAACAATTAACATAA
AAGTTTTTTAAACTCTAGACCAGCAACATATCTTCAAATATCAGTTGATAAGGTAAAGTA
TGTTGATAGCATTCTACCGTCACACTTATCTAGCAGATCTTTGTTAGGTAGATCTGCTAA
TATATTTTACGTAAGATTCGTTGTATGTGCGGGAAAATTTGTATCTGTTGTGGTAGTCAC
TCACCCTTTCTATGTATTAAAAACTGATACCTTCCATACTAGAAAAGACATTCAGTTGAA
TCCTTCTCCAAATCAAGGATACTATTGTCACTTCTCCATTGAGATTCGAAAAACCCCTCG
GGTCTTGTTAGAACTAAATTACGTTCATAGGGGTGGGATTTATATTGTAATTCCGCGAGG
TTTACACGAAAGATATCTCAACTCTAGCCGCACATCCATTCCGGTATGTACTCTCCCACC
ATTGGGTATTATAGAATGTAATAGGTTTCAAAGCGGATATCTTTTGCCCGGTGAGTTGTT
ACTTTTTCATTCGAGCAATGAAGTACATTCTAGAAGTTCCTAGAACCTTATGGAAGCACC
AAGAAAAAAGGAAGTTAAACAAAACACTGATTCAATAAGCAAGGGGGGAAGCTCCTTAGT
TTGACGACAGTAACAAAATGTTCGTATAAATTGAACGAAACTCAAGCCAATAAAGGACTT
TTCAGAGGCCTATCTCTTCTTTCTCCACAACTTTCGAATAAAAACCACTAATAAAAAGTA
AATAACAAAAACAAGAAAAAAAATAAACAAAACAATAATC
Chr coordinates Chr V from 364589-366517
w3c xhtml validator w3c css validator