Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAM1
Systematic Name YER106W
Strain S288c
Description Monopolin, kinetochore associated protein involved in chromosome attachment to meiotic spindle
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>MAM1 YER106W
ATGAGGGAAAAAAGAACAATTTCAAATAAAGACACAAACTATCTCAAATTCCCAAATAAA
CTCCAAAGATATTCCCGATTCTTGAGCAGGAAGATATCCAATACCAGCCCAGAAAAGCAA
CCGAAGAAGAACATAAAAGAACACTGTTTATCGAGTTATCATAAAGAACACTCGGTAAAA
CCAAAGCAAAACTCCGGTAATGTTGCAGCAAAAGAAGACAAAGATACGCAGCATTTACAA
AATAATGTCGCTAATGAAGAAGCAACGGAATGTCTAACAAGAAGTAATTTGAAAAAGTTA
CAAGAGAAAATTTTCGATAGAGAACTTAATGATATTGCCTGTGATCATTGTCTTTGTAGC
ACAGAAAATAGAAGAGATATCAAGTATTCACGACTTTGGTTCCTTTTTGAGTTGGAAATG
AGTGAAAACTGGAATGAAAATCTCCGCCTTAGTTGCTATAATAAATATGTGTATTCCGCA
ATTGATGAGTCGTGGAAAATGGAGAATATTCTACTTAAAGAACAAGAGAAGCATTATGAA
TATTTTCCAATAGGACAATTACTGATACCCAATAATATTGACTACACTAATAAACAGAAA
AGGAAGGAAAACATTGAAGACTTAACAATTGAAATTGATAGTATTATAGAGACAAACCAT
CAAAAGAAAAGATTTTTGCCGCAAAGTGTCCTGATAAAAAGGGAGGATGAAATTGCATTT
GACGACTTTCATTTGGATGCACGAAAGGTTCTAAACGATTTGAGCGCCACTTCTGAAAAT
CCATTCAGCTCTTCACCAAATACAAAAAAAATTAAATCAAAGGGAAAAACCTTGGAAGTG
GTTCCCAAAAAGAAAAACAAAAAGATCATAGGTGCTTTGGAAAGAAAGCTACATATAGAT
GAAAATTAA
Promoter Sequence
Download FASTA
>MAM1 YER106W
TATCAAAAAGAGTGGCGACAATCAATAAATTTTCAACAGAAGAAACAAAAGTGTTTGGGC
TAGGCTTAACTAGTTTCACTTTTAAAATGGTGTGCTCGATTTCATCGATACAGTGGTATT
CTGAACTATTATTGATATTCCACAAGATCAATTTATTATCAGAGGTTATCCAACAATAGT
TCAGTTCGAGAAAAATACCCATATCACTCTTTATTTCGGTATTTGAAACTTGTGATAAAA
CTTCATCTGGTATATTTGTCACTTGTTGTCTTTGGAAGGGGGTAAATGCACCTAATCCAC
CGACTTCATCTGAGAAATTATAATCCAAACCTTTACTATAATAGTCTGGATTATCTAGTA
TTGGCGTATTTCTGTCCCTAAAGCTCAAATCCTGGACAAATTCACTAGCCAACTGCAACG
GTTCAGAGGAAGTCAACCCGCTTATCTTGACGTGTGTAGTTACGTCACGAAGTTCTGATT
CAATAGTATTTCCAGCCTCGCCATACTTGTTTAATACATCTTTCCTGGTTTTTCTTTCGC
TTAGGAAGGAACGGCTCGACAGGTTGGGCTTACCGTTGTTTTGGTCATCTCTTGGCCGAT
TCCTTAAGCGATTTCCTCCTAAGGAAGCCGAAGCCGTAAACGTTTCGCGATCGTAATCAA
TCCTCTTTTTTAGTGGAGTTGAATACATCACAATTGAAATCCGAGCTGTAGTTTTTGTGA
AATGTTTCTCCTACAAACAGATTTTATTCTTAATTTCTTCTATTGATTTATAAAGCCATT
CAAAATTCAGATGGAAATTATTCATTAGAAATCTTTCCTCTCCAAAGTCGGGTAATACTT
TCTATTTTGTGTCACTAATTTTATAATACTTTAATCAGCAAATACTATAATAATAGAATA
ATCTCCAGACGTTCATGGAAAGTTCAACAATGGAAACATAGCCATATTTATTTACTAGCA
AAAGCATTTTCAGAGAATTTTTTTGTTTCCTGAAAAAAAA
Chr coordinates Chr V from 372326-373234
w3c xhtml validator w3c css validator