Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GLE2
Systematic Name YER107C
Alias RAE1
Strain S288c
Description Component of the Nup82 subcomplex of the nuclear pore complex; required for polyadenylated RNA export but not for protein import; homologous to S. pombe Rae1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLE2 YER107C
TGACGCCCTCAAAAATTCAAGTTCTTTGTTGTTTCCTAATCAAGCTTATGCTTCTAACAA
TAGAACACCAAACGAGAATTCAAATGTTGCTGATGAAACCTCTGCATCTACAAATAGTGG
CGATAATGATAACACATTAATTCAGCCCTCATCCAATGTGGGTACAACTTTGGGTCCTCA
GCAAACCAGTACTAATGAAAATCAGAATGTACACTCTCAGAACTTGAAGTTTGGGAATAT
TGGTATGGTTGAAGACCAAGGACCGGATTACGATCTCAATTTACTGGATACAAATGAAAA
TGATTTCAATTTTATTAATTGGGAAGGCTGAAGTCACGTGTTGAGTATTATAATAAAAAA
TAAAAACTCTTAATGACAGGAAACATAATAAAAAGCTAGGAGAATGGAGTTACGTATCTG
ACATTTCGCTAAATTTGGGGATGGGTTTAAGCCCTGTGAACTGAACCATTTTCACAGCAA
CGACTTTTTATAAACGGTTTTTTAGGATATTTGTTTTGTGATAGCTTTGTTTTTCTTCCA
TGATAAGATAGAAGTGTTTAATTTTTAGATAAGATATTGTACTTATAAAAAGAACATTTG
AACCATTAAATACAGGCACTTTTCTGGTTGATGTACACTCATTGAAGTAGCTTGGCATAA
TGGTAAATTAACTTTTGACATTACTATGATCATGATTTACGATGACCGTCTCGTCTCTTT
TTTTTTTTTGCATTGCTCTCTAAGATTTCTAAGATTGATATTTCATATGATGACGGTAGG
GTTTACAATAAGATATCTTAGTTGATCGCAATTGCTAAAGGTTTGTTCCGGTTAAGCACT
ATATAACCATTTTACTTGAACAGAGACTGACTTATAAGAATTGGGCAAGCTTACCATACC
AATCATTCCGGCACATCCACCTTGATCAAATATCATAAACCTTAATCTGCATATTACAAT
AAAATAAAGAAATACGTAAGAAGAGGAAAAGTGGGGAACT
Chr coordinates Chr V from 374545-373448
w3c xhtml validator w3c css validator