Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YER119C-A
Strain S288c
Description Dubious open reading frame, not conserved in closely related Saccharomyces species; deletion mutation blocks replication of Brome mosaic virus in S. cerevisiae, but this is likely due to effects on the overlapping gene SCS2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER119C-A	6320967 upstream sequence, from -1000 to -1, size 1000
ATGTGCATCCAAGACCCTCCCCTCATTTAGTAGACCCCGCATTGTTATGGTTAATAACGG
ATAGTTATTTGCCCAAGATAGCGCCTACTACACTAGGGAAACCGAACATGAATAAATTAA
ACAAGTAATATGTTACAACAGTGGTATAGTTATCGATTATTCTCCTATTTAAAAAATAAA
ACATATAAAAAAGTTAGGAAAGTATGATCTTTTAGTTCCTTGTTCTAGTATTGTAAAGGC
TACAGAAGGAAACAATAAAAAAAGATTGTAGAAAAACAAAGTAAAATAAAGACTGAAAGG
AAGGAAAGGGCAAAACACACACATATATAAATATATATTTAGAATACAGCTATATCCTCA
ATCTCCCTATTATCTGTAGAACCATCCTAAAACCAAGATAAGGAGTGCAACCAATATGAA
TATACCCATGCTGGATGATTCATTTTCTGCAGGTACGGTTGCGGCTTCCTTTATCTGGTT
CTGTGGGGCCGGAGTGCTGTTGGACGTTTGCTTCTCATTTTCATGAGGAACGGTTTTCTG
AACGACAGGTGGGACCTCTTCTTTCTTTACTTGGACGGGAGGTTGAGTTTCCGGTTCAGC
AGGGACCTCCTTTTCGTTTACCACAGCAGGCACTTCCTTTGGCTCACTGTCTTGGACTAC
TGGTTCAACAGTTTCCTTGTTTTCCTGTATATTTTGGTTCTGTGCTGGGTGTACATCTGG
ACTTATCAAATATTTGACTTTTATCTTTTTAGAGATAGCCTGTTGCTTGAACTCAGCCTC
CAAGTCGGACCAAACATCTGCAACAGCCTTGCCATTGAGGTCGTAAGGAGAAGGCAACGT
GATAACCAGGAACTTGTCACGGCACTTAAAGTCTGCGGCAGGCTCTTCAGTCAAACCCAG
GAAGATAACTTGAACCTGGATTGTTTCACCTGGAGCAACAACTGCGGCGTTTGGTCTCAC
GCAGTAAAACTTTGGGGCTGTGGTCTTGACCTTAAATGCA
Chr coordinates
w3c xhtml validator w3c css validator