Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YCK3
Systematic Name YER123W
Alias CKI3
Strain S288c
Description Palmitoylated, vacuolar membrane-localized casein kinase I isoform; negatively regulates vacuole fusion during hypertonic stress via phosphorylation of Vps41p; shares essential functions with Hrr25p; regulates vesicle fusion in AP-3 pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCK3 YER123W
TTTTTGCCAATTAGAGAAAAAATCGTCAACACTATTTTCTTTGGAAGTCGACCTGGAAGC
GTCTGAATCGGTGTCCAACGGTGAGTCCGAAGAATCTTGACCGTTCAAGACTAATTCTGA
TGGGTATAACTCCATATCCTTTTGAACCTTCTTGTCGAGATGTATCTTATATTTCTTAGC
AACAGGGCTCGTATATTTTGTTTTCGCGTCAACATTTGCTGTATTTAGTAGCTGTTTCCC
ATTGTTCTTTAAGAAAAAATCACGAGCCTTATGGTTCCCACCCAACTTAAACCTTCTTAA
ATTGTTAATTGTCCATTTATCTAATGTAGAAGACTTTACAAAGGTGATATGAACACCCAT
GTTTCTATGCACAGCAGAGCATTGAATACACAGCATCACACCAAAAGGTACCGAAGTCCA
AGTAGGATTCTTGTTACCACAATCAAAACAAACTCGATTTTCCATGTTGCTACCTAGCTT
CTGAAAAACTTGTTGAGTAGTCTGTTCCGTGGCAAATGTTTCTCCTTCATCGTTACTCAT
TGTCGCTATGTGTATACTAAATTGCTCAAGAAGACCGGATCAACAAGTACTTAACAAATA
CCCTTTCTTTGCTATCGCCTTGATCTCCTTTTATAAAATGCCAGCTAAATCGTGTTTACG
AAGAATAGTTGTTTTCTTTTTTTTTTTTTTTTTTCGAAACTTTACCGTGTCGTCGAAAAT
GACCAAACGATGTTACTTTTCCTTTTGTGTCATAGATAATACCAATATTGAAAGTAAAAT
TTTAAACATTCTATAGGTGAATTGAAAAGGGCAGCTTAGAGAGTAACAGGGGAACAGCAT
TCGTAACATCTAGGTACTGGTATTATTTGCTGTTTTTTAAAAAAGAAGGAAATCCGTTTT
GCAAGAATTGTCTGCTATTTAAGGGTATACGTGCTACGGTCCACTAATCAAAAGTGGTAT
CTCATTCTGAAGAAAAAGTGTAAAAGGACGATAAGGAAAG
Chr coordinates Chr V from 404813-406387
w3c xhtml validator w3c css validator