Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DSE1
Systematic Name YER124C
Strain S288c
Description Daughter cell-specific protein, may regulate cross-talk between the mating and filamentation pathways; deletion affects cell separation after division and sensitivity to alpha-factor and drugs affecting the cell wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DSE1 YER124C
AAGCTGTGGCTTATGAAAGTGAAAGTCGAATAACACTATATTCGGTAGTTCCAACTAAAA
GGTACTTACACACAAAAACAAGCAATTATTTCCTGCTGTTTTATTTGCTACGCACTCACT
CTTCTAAAGAAGGACTGAACTGAAATTTTGACTCACTTGCAAAATGTGCTTCACGAATTA
TAGTAACAAGTCCAAAACTGTGGAAAAAACTGACAGCGCTTATTATCTTATAATCGTTTT
TGTTTAACGAAAAAGTCGACTCTTGTAGCTCTAACGAAGAAAATGGAAAACAGCCTCAAA
ACACAACAAAGTCCTTTTATCAATTAGCAGATGCGATACTCGAGTACCCTAAAAATGGTT
AAGCGTATGTCTTTTAATTGTCGAGATAGAAGCCCCCTCCCCCGCCAGCAAAAAATATTA
CCTTTCACCATGAAGATCACTGCAATTTGGTCTTTACCAAAAATTTCCACTAAATTTTTG
TTTTTTCCCCTTTCTCGTATAATGTCATTATGTACGTAAGATCACATGATCGTATACTGT
CACGTGACTGTGCGGCTGGTCTGCGCCAGCAATTTTTTTTTTCTGCTCTCAAATGTAAAC
AAACCAGCAGTCTGTTTTCTAAACAAATAAACATTAAAAGGTAAACAATACCAAATAATA
ATAGCAGCGTCAAAGCTACATTCTCAGTTCTCAAAGCTATTGTGTTGATTTCTATGTATG
ATTCAATGCCGGCATGATGTTAAATTTGCTGGTTTACTGAATAAGGCTTGGTTCATAACC
AATTTGTAGTCATGACGACATAGCTGGGTGGGTGCTTACTGGTTTACATAAATAAGTGCG
TAAACGTTTTACAATATATAAAAAGGTAGAAATATCTCTCCCAAGCTTTCCTCAAACTAT
CTTTTGGCTTCTTCTTCTTGCATGACTTCCAAATTTTAATCTGTGTTTGCTAAAAAATTT
GATTGTAGGTGTGATAGTGAGAGTGACACGTATTAATATT
Chr coordinates Chr V from 409063-407342
w3c xhtml validator w3c css validator