Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER137C
Systematic Name YER137C
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER137C YER137C
TGTATATGATAATATATTAGTAGTATGACAGCACACTAGTAGCAGCAGTACTAGTCGATG
GATGATCGTTTATTCTTCTTTCAACACGTTCTAAGTATTCTCATTTTATCCTTCTTATAT
TCCGCTGCCGCCTGTCGCTACTCACTCTACAACCAAGGTAAGGACTACCTACAACAAGAA
CATGATGATAAACATTGACATGCACCTTCCAATCGTCATTTATATTCGAAAAGAACAAGA
ATAGGACATTAAATCAACTTACTCTTCCAACATCCCTCATTGGGACGGTTAATTAGTTCA
AAAAAATGTTAAAAAATATGGTTCAGGACACACTCCATCCCCGAGGGAACGGCCACAATG
TGCGAGTAAATCCTGATGGCACCGCCAAATTAAACCGCCGAAGCGATCAACTTGCACAAT
TATCCGACTGATATGTGCTATCCCGGCCGCCTCCATCACGGGTCACCTTTGCTGACGCTG
GATAAAACTCCCCTAACAGCGGTGAAGGTGGAGCCCCTAAGGACCCAGAACTACCTTGCC
GCACCAGACAGAGAGACGGATTCCTCACGCCTCCTGCCAACGGGCTGCCCGCAAAGATCG
ATTTATTATAGCCGGGACACTTCAGAACGGACTCTCCCGCCTCCGGGCAGACAGCTCTGC
CCAGGACAAATTTACGACGGAGGAAAGACGGTTGCCACAACAGGGCACGGTGCGGAATAG
AGAACTATCCCTTGCCCAAAGGGCGTGCAATCCGTGTCTAGCCGCGAGGAAGGATTTGTT
CCTCGGCCAGAATTCTCAACGTATCCCATCCCACCAGAAAGCCATTACAGCCTAGCACAA
TTGGAATAAACTTTCGATTTTATACTCCATTTTCTTTCCTTTACACAGAAAATTTGTCAG
AAGATTTTCAATGAAAAGTTCCTGGCGATGAGGTTGACACTAATACAATATAGTCATCGT
AAGTTTGTTAAAAGAATACCGAGGGTTGTTATAACAAGGA
Chr coordinates Chr V from 441819-441373
w3c xhtml validator w3c css validator