Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UBP5
Systematic Name YER144C
Strain S288c
Description Putative ubiquitin-specific protease, closest paralog of Doa4p but has no functional overlap; concentrates at the bud neck
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UBP5 YER144C
CACAGGGCTCGCACGCCTCTGCTTACCCATTGCCCGTTGTGGTTGGTTTGATATGTGGTG
GTCTTGTTGGGTATTTGTTGTACTATGGTGCTTCGAAATCCTCGCTGCAGATTTTCTTGA
TTTTGTCTACTTCGATCTTGTACCTGATCTCCGCCGGTCTTTTCTCTCGTGGTGCGTGGT
ACTTTGAAAATTACAGATTCAACCTTGCCAGTGGTGGTGATGCTTCCGAAGGCGGTGATG
GTAATGGGTCTTATAACATCAGAAAGGCCGTTTACCATGTCAATTGTTGCAACCCAGAAC
TGGACAATGGGTGGGATATCTTCAATGCTTTGCTTGGATGGCAGAACACCGGCTACTTGT
CATCCATGCTTTGTTACAACATCTATTGGTTGGTTCTTATCATTGTGTTGAGTTTAATGA
TATTCGAAGAAAGGCGTGGTCACTTGCCTTTCACCAAAAACTTACAATTGAAACACTTGA
ACCCAGGATACTGGATCAAGAACAAGAAAAAGCAGGAGTTGACGGAAGAGCAAAAGAGAC
AACTGTTTGCCAAGATGGAGAACATCAACTTCAATGAAGATGGTGAGATCAATGTGCAAG
AGAACTACGAACTTCCCGAGCAAACTACCAGTCATTCCTCGTCTCAAAACGTCGCCACAG
ACAAGGAAGTCCTCCACGTTAAAGCCGACTCTCTTTGAATGAAGTCTAGCACAGGGTGGG
AGTTTTCCACCTATTTTCTGTTGATAAAAATACTACATTTATATACATATATACAATAAT
TTCTAATATCGTTTTTATAAAGTTGGCCTTGTCTGTACGGCGTCGCAAAACAAGAACCCC
TGGTCCAATTGATCTACCGGGCATTGATTTTTTTTCTTTTTTCCTTGCGCCTCACTTCAA
CACATCAAGTAAACACCAGCTATATTTAGTTGCTAGGTATTCTCCAACGTATGTGGAGTC
CTTTCTTTATTATCTCTCTACACAAATAGGCACAAGCGTA
Chr coordinates Chr V from 460223-457806
w3c xhtml validator w3c css validator