Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FTR1
Systematic Name YER145C
Strain S288c
Description High affinity iron permease involved in the transport of iron across the plasma membrane; forms complex with Fet3p; expression is regulated by iron
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FTR1 YER145C
AAGCCACTCGACAGCGTCTTCCAGTATAACGTTGACGAAGTCGTCGAAACCAACTAACGT
GCCCTCGAACTCGCGGTTCGACTGCAGCACAATCAACACTTTCTGGTTAATTGTTTTATC
TATGACTTCCAAAGGCAAAATCTCCGGTAGACTCATTTTGCGCGCTTCTGTGTATGCTTG
TGAGTGCACGTGTATACGCTATGCTTGTTGTGAGACCATCTATCCGCCAAGGAAGCCTTT
TTCGCTTTCTCTGTATTTTTTCTACTTCAATAAGAAAGCAAGTATTCTGTTTTGCTACCC
GGATGCAAAGACAAAACCCGAGCATCCGGGTAATAAAAGAGCAGGGTCCGGCTGAAGGTG
CCAAAAAAGACCAAAAAGGGCTATATTATCTCTCTCTTACGATTGCCTCTGGTTAAAAAA
TGAAATAGATAATAAAAGGGCAGCAAAGAAAAAAAAGAAGAATACAATATACGTATACGT
TCTCAACAATTTTTCGTCCTGTTTTTTTCTTGACCACGGTCACTACTAACTCCTGAGACA
TCAGACCAACGTGTAGAAAAAAAGAAATCGGGTCCGGCACTGACACACGCTCTGCGCCAA
TCAACCAGGGCGCATCGAGCATTCTTTCCAGGCCAGGGTGCAGAAATACTATTATTAAGT
GCGCGAATACTGCTGGTGCATTAAACGAGCGAGTACAGTGAGCCCGCCGCTGACTGCCGA
CTCACGCCAGGCCGCTATTTCCTTCCCCCGCCCGCGTAAGCCGTGCCGAGCACCGTCGCA
GCAGTAAGAAGGTGCGCATTTCATTCTCTGCACAGCGTAGATGAATGCACCCGATTTCTA
AGTTGGTGTTGCAAGGCCCGGTGGAAGCGATGGGCTGTAGTTCGACCTTGAGCTTTTAGT
TATATAAAATGCTCAATGTGAGCAAAAAAATACATAACACGACGGATTGTACGTTGTCGA
AATCTTCTCTCAGCAGGTCATCACACATATACTTCCCGCC
Chr coordinates Chr V from 461740-460526
w3c xhtml validator w3c css validator