Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FTR1
Systematic Name YER145C
Strain S288c
Description High affinity iron permease; involved in the transport of iron across the plasma membrane; forms complex with Fet3p; expression is regulated by iron; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FTR1 YER145C
AAGCCACTCGACAGCGTCTTCCAGTATAACGTTGACGAAGTCGTCGAAACCAACTAACGT
GCCCTCGAACTCGCGGTTCGACTGCAGCACAATCAACACTTTCTGGTTAATTGTTTTATC
TATGACTTCCAAAGGCAAAATCTCCGGTAGACTCATTTTGCGCGCTTCTGTGTATGCTTG
TGAGTGCACGTGTATACGCTATGCTTGTTGTGAGACCATCTATCCGCCAAGGAAGCCTTT
TTCGCTTTCTCTGTATTTTTTCTACTTCAATAAGAAAGCAAGTATTCTGTTTTGCTACCC
GGATGCAAAGACAAAACCCGAGCATCCGGGTAATAAAAGAGCAGGGTCCGGCTGAAGGTG
CCAAAAAAGACCAAAAAGGGCTATATTATCTCTCTCTTACGATTGCCTCTGGTTAAAAAA
TGAAATAGATAATAAAAGGGCAGCAAAGAAAAAAAAGAAGAATACAATATACGTATACGT
TCTCAACAATTTTTCGTCCTGTTTTTTTCTTGACCACGGTCACTACTAACTCCTGAGACA
TCAGACCAACGTGTAGAAAAAAAGAAATCGGGTCCGGCACTGACACACGCTCTGCGCCAA
TCAACCAGGGCGCATCGAGCATTCTTTCCAGGCCAGGGTGCAGAAATACTATTATTAAGT
GCGCGAATACTGCTGGTGCATTAAACGAGCGAGTACAGTGAGCCCGCCGCTGACTGCCGA
CTCACGCCAGGCCGCTATTTCCTTCCCCCGCCCGCGTAAGCCGTGCCGAGCACCGTCGCA
GCAGTAAGAAGGTGCGCATTTCATTCTCTGCACAGCGTAGATGAATGCACCCGATTTCTA
AGTTGGTGTTGCAAGGCCCGGTGGAAGCGATGGGCTGTAGTTCGACCTTGAGCTTTTAGT
TATATAAAATGCTCAATGTGAGCAAAAAAATACATAACACGACGGATTGTACGTTGTCGA
AATCTTCTCTCAGCAGGTCATCACACATATACTTCCCGCC
Chr coordinates Chr V from 461740-460526
w3c xhtml validator w3c css validator