Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPI1
Systematic Name YER150W
Strain S288c
Description GPI-anchored cell wall protein involved in weak acid resistance; basal expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; SPI1 has a paralog, SED1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPI1 YER150W
TGTTTCAATTCATCGTATTTCAATGGATACTCTTCGTATCGTTCTGCACTAAAAAGCAAA
GGGTTCGCTCTTCTCGAGAGCTCTAGATCAAATTTATGCATATGAAACGTGATATCCACC
GTTATTCTCCCTCTCGAACACAGGACTTCGATAGTATCTTTTGTAATCTGTTCAGCTCAA
CTATTTGTTACCATACCATCATCATCACTTTACACATACTCATCATGTGTTTATTGACGC
GAGCGCGACTTGCAAGAAAAGGCATAATTGTGGCGAGGTAATGAAAAATTTTTGACGTTT
CCCTCATTCATTCATACATAACATTTTGGGATTTTGGAACAAGGCGAGAGGAGAACGTCT
TTGGACCACTGTAATAGTACACAATGCAAGATATTTTAAGTTTATGCTAAAAATCCAGAA
GTGACGCTTCATCAACGGTGTCAATATGGACCGAATTTTAGTGTATCTTCAATTGTAACC
GTGAGGAGTAGACTCTTTGAATACGGGGGAAGAAGAAATATCATATTCAAAGCTAATTCA
TTGAAATTAGTGCTTGTCTCATCTAGCCTTTAGTGCTTAATCTCTGGAGGAGCACATATG
GGGTTAAAGCCATGCCGGGACTGGGGGCCCCTATCGGGGCTCGAACCCGAATCCCGCGAG
TATTTATTTGAAGGTCCGGGACGCAAGTTACCTAATCTGGTTAATTGATATCCCATTTAG
GCGATGACGTTCCTTCCCCTCACCCCTCGGCTTGTTAGAAGATCTATTGTTATAGCCTCC
TCTGGAAGAATTTATGCCAGATGAAGAAAAAAACTTCTCGAAGTTCCCAGATGCCCAAAT
GAGGGCTTTCCATCCCTGTTAGCTGGAAAAGTGTAAGTATATCTATATAAAAAGTCGGCC
TACTTTTGCCAGGTTCGTCTTTCACTTGCACTCTCTTGATCTTACTTTCTACTCAAAAAG
AATCCAATACACAAAAATAAAATCAGTACTATTACTAATA
Chr coordinates Chr V from 468370-468816
w3c xhtml validator w3c css validator