Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SPI1
Systematic Name YER150W
Strain S288c
Description GPI-anchored cell wall protein involved in weak acid resistance; basal expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; similar to Sed1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SPI1 YER150W
TGTTTCAATTCATCGTATTTCAATGGATACTCTTCGTATCGTTCTGCACTAAAAAGCAAA
GGGTTCGCTCTTCTCGAGAGCTCTAGATCAAATTTATGCATATGAAACGTGATATCCACC
GTTATTCTCCCTCTCGAACACAGGACTTCGATAGTATCTTTTGTAATCTGTTCAGCTCAA
CTATTTGTTACCATACCATCATCATCACTTTACACATACTCATCATGTGTTTATTGACGC
GAGCGCGACTTGCAAGAAAAGGCATAATTGTGGCGAGGTAATGAAAAATTTTTGACGTTT
CCCTCATTCATTCATACATAACATTTTGGGATTTTGGAACAAGGCGAGAGGAGAACGTCT
TTGGACCACTGTAATAGTACACAATGCAAGATATTTTAAGTTTATGCTAAAAATCCAGAA
GTGACGCTTCATCAACGGTGTCAATATGGACCGAATTTTAGTGTATCTTCAATTGTAACC
GTGAGGAGTAGACTCTTTGAATACGGGGGAAGAAGAAATATCATATTCAAAGCTAATTCA
TTGAAATTAGTGCTTGTCTCATCTAGCCTTTAGTGCTTAATCTCTGGAGGAGCACATATG
GGGTTAAAGCCATGCCGGGACTGGGGGCCCCTATCGGGGCTCGAACCCGAATCCCGCGAG
TATTTATTTGAAGGTCCGGGACGCAAGTTACCTAATCTGGTTAATTGATATCCCATTTAG
GCGATGACGTTCCTTCCCCTCACCCCTCGGCTTGTTAGAAGATCTATTGTTATAGCCTCC
TCTGGAAGAATTTATGCCAGATGAAGAAAAAAACTTCTCGAAGTTCCCAGATGCCCAAAT
GAGGGCTTTCCATCCCTGTTAGCTGGAAAAGTGTAAGTATATCTATATAAAAAGTCGGCC
TACTTTTGCCAGGTTCGTCTTTCACTTGCACTCTCTTGATCTTACTTTCTACTCAAAAAG
AATCCAATACACAAAAATAAAATCAGTACTATTACTAATA
Chr coordinates Chr V from 468370-468816
w3c xhtml validator w3c css validator