Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OXA1
Systematic Name YER154W
Alias PET1402
Strain S288c
Description Mitochondrial inner membrane insertase, mediates the insertion of both mitochondrial- and nuclear-encoded proteins from the matrix into the inner membrane, interacts with mitochondrial ribosomes; conserved from bacteria to animals
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OXA1 YER154W
ACAGCGATGCTCCACCCAGATTTATGTGTTGATTTCAAATCCTCTTCTCTTTATCACTAG
TTCGGCATCCAGCAGCGGCAGCCCGCGATAACTTTGACGGAACTCCGCCAGCACACGTCG
CGCCTGCGCTGGGCCGGGAACATGCCAAAGGACACCAGCCAGTAGTAGCGGTAGTGACCA
TTCGTTCTTTATCACTAGGGGCTGTCGTCCAAACAACGCCAGGGCAGCTGCTTGCTCATC
TTGCTGCATCAATGCTATGCCCATAGCCTTGGTCATTTGCGGGAAGTCGCGCAGCCTTAA
TGGCGGCTGCCCTGGTAGCGTATCCATCTCCTGCAAGAATACCTTCCACTTTTCCCTGAG
CGCCGTGGAGTGCATTGTGCCACGCGCAAACGCTTCGACTTTAATCCGTCTAAGCTCATA
CTCAATCAGTTCATCTTCTGGGCTGGTGCGACGATCGCGATTCATCGCCTGGTAGTGCTG
GAGGAACTGCGCGGGTAAGAAGAGCCTGTCCTGGTACAATGCTACGCCAGCCATTTCACA
TAGCAGGCGGCCCTCTACTGGCAACCGGCGTGGCATCACATGCTGATACCACATGTATGC
TATAGTGTCGGCATGGGCAAGCGCAGCGGCTCGCGCTAGCATCGTGTGCAGCAGCTCCAC
ATCCACGCTGGTCTGCTGCTGCTGACGCAGCAGCGCCAGTGCATCGGACATTTTCCCGTT
TAAACTGCTTAACAGTATTCGCGACCGCACATCGGTGGTCACCAGTCTTTTCGTGATAGT
CAACATGACGTGTTCCGTTCTTATGTTCGAGCTAATGCCTCGTCTGCTCTTCCACGTTCA
GATGTTCCCTTGATTGCTCAAAACACTCTCAGCAGGCCGAGATTTCGATTTTAGCCAGCA
GTACGGAAGTAATCCGAGCCATGAAAAATTTAACCAGTGGCTCGCCCTCTATACGTATCT
GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACG
Chr coordinates Chr V from 475020-476228
w3c xhtml validator w3c css validator