Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YER158C
Systematic Name YER158C
Strain S288c
Description Protein of unknown function; potentially phosphorylated by Cdc28p; YER158C has a paralog, AFR1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YER158C YER158C
TCTATGCGTAGAAGAAGGCCAAACACAACCGGAGGAAGAGAGTGCCTGAGCAGAACGGGG
CGATGTAACTTAGTGTAAAATGAATACCACATCTATATATATCCATATACCAATGTATTT
ATATCTATATATGTCTGCACATATATATTATACTCTATTATCAAGGACGAAACGTAATCA
CATATGTATCAACGACAACCGGCGCCTCATGTAATCTGTACCTTTCTCTACAGTTACATA
GCATGAGTATGTGTATTCCTATTTAGGAAAAAATTAACGCTATTCTTAAGGTTTACGAAA
GAGCATGCATCACCCCATACGATCCCCGGAGTAACTCCCGCAGGTGGGTGTGCGGGCGCT
CAGCCTGCTATACGATTTAGAAACGAGGCGCTGCGTTACCGTCTGTGACTTCTTAAATAA
GATTTTTAGGTGTCCCATCCTTCCAACTGTGCCTACACCAGAAAGACAAAAAGAAAGGAG
GAAAAAGAAAAGCTAATTTTTTCTTTCAAGTGCCAAAGGAAGCGGACGAAGGGCTAGCTC
GAGGATTCTTGCAGCAACGGAGGAAGGAGTGTGAAAAATCGTTAAGGTTCTCGCGGTTTG
CACCGCGTTGCGTTCGAGACACCAAAGAAATGTATACTTGCAGATTGTGCTGATATGCTA
GTTTAAGCCCAAGCGGTCTGGTTGTTGGCTTCTTGCTTCTGATAATTACTTAATATTAAT
ACCTCAAAATTACGCACTTGGAAATATAATACAGGCGTACTCCTTTTGTATTTGTCTTTC
ATCTGCACTTGACTTCAGCTTTCTTTACTACTGCTCTATATACAGTAATCTGTTTACACT
CATCATCAAATAACTGAAGGAGAGCTACGGCAAAATACTTGTTTATTGTCATATTATTGC
TATTGTTGTTTTTTCCGTGCTGACACAATAGGATTCATTTTACCAGGCTAAACACATAGC
CACCACCGCTCGCTACTACTTCCACTCACTCTTAATCAGC
Chr coordinates Chr V from 490578-488857
w3c xhtml validator w3c css validator