Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BCK2
Systematic Name YER167W
Alias CTR7
Strain S288c
Description Protein rich in serine and threonine residues involved in protein kinase C signaling pathway, which controls cell integrity; overproduction suppresses pkc1 mutations
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BCK2 YER167W
AACCTGGATGACTTCACCCAAGGAAACACAAGATCTTCTTCAATCGCCCCAATTTCAGCA
GGCCCAAACGTTCGGAAGAGGCCCATCAACCAACGTCAGGTCATCCTTGGACCGCACAAG
AGAACAGATGATCGCCACTAACCAACTAGATAACCGCTACTCTGTGGAAAGAGCGAGAAC
ATCTCTAGATCTACCAGGCGTAACTAACGCAGCCTCCTTAATCGGAACACAACAGAACAA
TTAATAATGATATCCGAACCATAGCTGATGGAACTCCGCTTTTCACTGTATATATAATAT
TACATAATATTACTGGATAAGCCTTAGAAGCCTTAGAAGCCTTAGAAGCCTTGGAATTCA
TGCATACTACAGCGTTAACTCTTTCTTTTAGCAAGTTTTAGTAGCGGACGTGTGGGTTTC
TTTGTTCTATAATTAACACTCCCGGTTAACCCGGATCGCTATTATTCAAGGACGCACAAT
GGTGGGCTAATTTTTTCTTCCGATGGAAAACTGACGCCAGCACTTTCCAGCGCTGGGAAC
TCTCCACTAACTGGCAAAAAAATTGATTAAGGTCATGATCAAAGGAATTTTTGAAATGTT
GTAAAGTAGAGTTAAGAATTAATCAAGCCGTGATACGTATGTTTTTGACTAGGTGAGAGA
CTATATTTATCAAAAATAGTTTTTTATACTAACAGAAAGTTTATTATATCATAGAAATCC
TAGGCCTATTGTTATTATTTGCGTGAAAAAAGGTTCATGCCTAGTTATTCAGGATATTAA
TCAGGCATAGTCATAGTTTTGTAATACACGTCTTTCACTCCTATTTCCGGTTAACATTCG
CTAATATCCATCAAATTATTGACTTTTTTTTCAGTGGATTTGTTGTTAATAAAGGAAACA
ATCAGATCAGCCATTTAGGGAAGTCTTTTAAGAAAGCTCAGAAGGAGATCTAAGACAAGA
AGCAAGGCAGTCTTGATTTATCGCTCAAAACCAATAGCAC
Chr coordinates Chr V from 518216-520771
w3c xhtml validator w3c css validator