Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TMT1
Systematic Name YER175C
Alias TAM1
Strain S288c
Description Trans-aconitate methyltransferase; cytosolic enzyme that catalyzes the methyl esterification of 3-isopropylmalate, an intermediate of the leucine biosynthetic pathway, and trans-aconitate, which inhibits the citric acid cycle
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TMT1 YER175C
TCTTTTAAGAGGTGCAGTTCAAGTAGGATTTAGTTGGAAATGATAACTTGTTTGAGTAAG
CTTTGGTTCCGCTTGTTATGACCTGCTTCATTCTCATATAACCTCATTTGTTAAAAATCT
AAAAAAGAATCAATTTCTTCGATTATAAGTGCGTACCAAAAAAGCGGCTAATTTTGGTAT
TTGTGATATCAAATATACATTGCAACCCAATTTTCATCATTGCGCTTGAGTTTACTATTT
CAAGTCGGTGTGGTGAAAGGTCTCTCCAATATTTGGGTACCAATTTATCGAAGCAGCTGA
AATTTTACGATGTTAGATCGATTCCCGTGTCTGACAGTGTTTGGGCTGCAAATTTTTTGT
GCTTCTTGAAGGCAACATGTGAGATCGGGAAGTAAAGCCCGCCAGAGTATGTTCTCAGTA
AGTCATATTGACATAACACTTGGATCAATTGCGTATTTAGAAATTAATTCCTGTTTTATT
TTAAGATGCTGACATTTCAATTATAGATTTTTAGCCTGTCTTATACCACCTAGAATAATT
TGCTAATGTTTAGAAACTGATCTTGGTGCTCACGCTAATATTAAAAAATATACCCTGCCT
CAATATCATTATGAGTATTTTATTCTCAAATATCATCCGCGAATTTTCTTGCAGAATATT
TCTACAACCACGTTTGTTTTGACTAAAACAGATAAATGTTTTATGTAGTCTCATGCATTG
TTAAATGACCAATAAAAAGGGTGTTCCATCAACCTATCTAATCAGAAAAATTAGGTGCAA
TTCTGCCGTTGTTTACTATAAATGAATCACACCTTATGTGTTGATGTTCATGACTCACAG
TAATATCCTTTTTTTTTCTGGTTTTCCGAAAGTTTATCTTCCTTATTTTCATTTTTAAAG
GAAAAGGAATGTAACTAATTTAGTATGTTTTCGTTGTAGCAGTCTTTATTAGTTGTTATG
AGAATTATCTCCTAACAAGATAACAAAATAAGTGATAATA
Chr coordinates Chr V from 540363-539464
w3c xhtml validator w3c css validator