Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TOG1
Systematic Name YER184C
Strain S288c
Description Putative zinc cluster protein; deletion confers sensitivity to Calcufluor white, and prevents growth on glycerol or lactate as sole carbon source
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TOG1 YER184C
GGTGTGATTTTTAGTTGCTTGTATTCAGCATCCTCAAGACTATCGACCTTATCATCAGAT
GACTCAAATGGATTATTTTTCAATGCCTTAGAAGATTTTCTCGCAGCATATAAAGTTTGA
ACGGCAAAAATGACTGTCATTATAATGAAGAGTACGACAAATACGATTGCAGCCGCTTTA
CTTGGCGTATAGTGGTAAAGTACGAACCCCGAATCAGTTGTGGACATTTTGGAACGTTGA
TGGACAATAAAAGATTAAGTAGCTATGTAATTGGACACTATTAACCTACTATCCTGGACA
TTTTGAGGCAAGAGACTATACATCCCACAATTGATTCGGTAGGTGCTTTTATACTGATTC
ATTTGAGGTCTTGGCATTTGTTCAATTGAAGTACATTTAGTTGAAAAGTTGAGATTTATT
TAGGATGAGCTTGCCGCGGCATGGGGAAAGAAACACTTCATCCTGTATGGAGAAAAACCA
CTTTGCCGCGGCACATCAAAACAGGGCTGAAACCTTCAGTATGCGCGATACCATTACACG
ACAATCGCATGGCTTAGTCATAATAGATCGAGGCGCTCATATACATGGCAGCCACAATAT
TTGAAGGTCGACAAATAAGGACAATATCAACGGTTAGGATACCGAAACTTGAATATGGCT
GGTTTCTCAGGAACAGCCGATACTGTCCTGATCTTAACTTAAGGTGCGGTGAAGTAACCT
GGATTCAACGCTGCATGAAAGACCTGATTAGGCTTATTTGATAATCCAACAAAAAAAGTG
ATTGGTTGGTTTGCTAGTATTCAAAAATAACTATTTTGGAGTACTTTGTTTGTTTGAAAG
GCTGGGTAATAATTTTTTTGATGTGTGCTTTGAACAGTAAAAACTTTCTTCCTTTCTATA
AGCTAGAAGCAAATCCAAATCTCATCGAATAAGCGCATTAGGTTAACGACATTATTGTTG
TTTAAATTTTAAGCTTTTTAGCTTTTTATATTTTATTGAG
Chr coordinates Chr V from 558680-556296
w3c xhtml validator w3c css validator