Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AUA1
Systematic Name YFL010W-A
Alias YFL011W-A
Strain S288c
Description Protein required for the negative regulation by ammonia of Gap1p, which is a general amino acid permease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AUA1 YFL010W-A
TAAATATTCTTGTACTCTGGTAAACAGAAATAACAACAGATAATGGATTGATGCTTTACT
TCTATTTCATGGAGATTGGTTTTATATAATAGCCTTTATTAATGGCGTCACAAATTGAAA
AAAAAATTAAAAAAAATAAGACGGACACATTTGCGACGCCGGTGAATAAATGCATATAAG
TAGTTTATAAGCTAGCTACTACTCAGAAATAATTTCAAAAAAAAAAAGAAGTGGGCACTT
TAAAATGAAGATTAGCTATAGTAAATTACTGTAGTATAACAACTACCTGCTATCTTTCTG
AAAAAATCAGGCAATGTAAGGTCAAACTTGTACCATCGACATATATAATGTTTTGAGATA
TAAGTAACTAGAGACCAGTTTATACAGGATCTTACCTCTTTTTACCGTTATGAAAGCTTT
ATTACTGCGTTGTTAGTAAACACACATATTATTTTCGGGTAGTCCTGTCGATGTTCCAAG
GCTTTGCATTTATCATTGTTTCCGCTTCATCGGTGGTATTAGTTAGTGTATCTGTATGTG
AAGTATGTGGATAGGTGCTTCTATTATTGGAACAAAACACCTTAAACGCGCACTAGGTTA
TAGGAAAGGGTCCATTATTCAAAGAACGGCTTATTGAAAAGTATGTTGTAAAGCTCGGTC
ATATCGCGCATAGCCACGATAAGGCGTGGTGCTGCTTCATAGATTGAGAGGCGCAGTCAA
TACACAACCATACCGGTAGTTTGATAAATGATACTATCATTCCGGAAGCTCTCTAGTAAG
CTGTAGGTGGCATATACGGTATCTATCATCTAGTAATAGCTATTGATTTTTTTCTCGACT
ATGCTATATGTGTTGTGATGGTTCACTTAGAAGTGAAAAAGTAGCAATAAATTAGACAGA
CAGAAGTAATTGAAGCTACATTCAACAACATGGCTAAGTAAAAAAGCGTAGAATATCATG
ATGGGTTTTTTTATCTTTTAATTGCTTTCTATGTAGTATA
Chr coordinates Chr VI from 114990-115274
w3c xhtml validator w3c css validator