Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP12
Systematic Name YFL014W
Alias GLP1, HOR5
Strain S288c
Description Plasma membrane protein involved in maintaining membrane organization in stress conditions; induced by heat shock, oxidative stress, osmostress, stationary phase, glucose depletion, oleate and alcohol; regulated by HOG and Ras-Pka pathways
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP12 YFL014W
TATGATATAGGACTTCTCTCTCTTTTTTTTTTTTTGTCCAGGTGGAGTGCGATTTGTTCG
TTATATGCCTCATTCCTTAATTTTTATCAGTCAGAACGTTATTTCGCGCTGCAAGTTCCT
TACTTTTCCATAGAGTTCCACAGGATGTAAAGAAAAATAATGATAAAAAAAAGCAGAACA
TATTACCCTTCTTTTGGAGCGTACTTCCATCTGTTACCCGCTCATCCAAATGCACATTCT
GTTACCCTCTTGTTCGGTATTTTTCGGAGTTCTCCTTTTCTCCTTCTTTTCCTCTTGATA
CACAGAAAAGTGGGAGAAGGTAGGGGGAGTCAGAGAATGAAGAAAAAAAGGGGACGCGCA
AATCCAAGTGAAAATCTCCGGGAGCGGGCGGATCCCACTAACGGCCCAGCCGAAAATGGA
AAAAAAGGGTCGGTGATGTGTGGGTGCCAGCTGGCGGTAGCAATGACGACGTGTTGACGG
GCCCTTGGCTCTTGGGACAAGGACTAGAAGCCAAAAGCCAGAGGCGGTAAAAATAGCAAG
ACTAGAATATTGCTGGCATCTGTTAAGGGGATATGTTGCAACTTGCAGGGGGCGGCACAA
AATAACATAGAAACGTAGTAAAGAGGGGAAAAGGAAAAGGAAAAGGAAAAGGAAGGAAAA
AAACCCATTGACGTAGAAATTGAAAGAAGGAAAGGTATACGCAAGCATTAATACAACCCA
CAAACACAGACCAGAAGCACTCTAGACGGAGAGTAACTAGATCTACAGCCCCTGGAAAAT
CGTTTGGTCAACTTTGAGGTTCCGGTCGTCCCCCTCTTGATCTGAAAGGTCTTTCTCTAA
ATCTATATTAAAACGTATAAATAGGACGGTGAATTGCGTTCTACTTCCTCAATTGCGTTT
GATCTTATTTAATCTCTCTCTAATATATAGAAAAAAAAACCATCTGATTATTCGATAATC
TCAAACAAACAACTCAAAACAAAAAAAACTAAATACAACA
Chr coordinates Chr VI from 107256-107585
w3c xhtml validator w3c css validator