Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GAT1
Systematic Name YFL021W
Alias MEP80, NIL1
Strain S288c
Description Transcriptional activator of genes involved in nitrogen catabolite repression; contains a GATA-1-type zinc finger DNA-binding motif; activity and localization regulated by nitrogen limitation and Ure2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GAT1 YFL021W
CAATTCATCTAGTTTTTTTAGAATTTCTAATTGGAAGTCAGACATCTTTACGTTAGGGGG
TGAGAGAGGGAGGGGGGTGCCTTTAATGTATATATACGTAAGATATATATATATATGTAT
ATATATGGAAATGTATTCACAACTTTACATGTGCATTAACCACAAGTACTGCGTACGTTC
AAGATTACAGCAATGCGTTTTATTAATTTTTCAAGCATTTTTCACGTAGAGAGGAACAAA
GTTTACTGAAAAGAAAAGAGGTAGAGAAAAACAGAAAAATTTTTTTTTTCTGTTTTTCCT
GCCTCTTTTCTTTGTTTGATTCAATATGGTCGACCGGGTAAACCCCTGATAAAACGATAC
CAAAGCCGGGTCACCTAACTTATGGCCAAATGCGACCGGTCCCGCTTTCCGATTTTAGCC
GGCGAAGACGTACTTGGCGCCATAATCAAAACCTAGCTTGCCCAATACTTCTGAGTTCTA
CGTGGTGCAAAAATATTTTTTTTTTTTTGAAAAACCTACCCTATTTCATTATAGATGCAT
CCATCAGTATTACGGTGTCCTCACACAACCCTGTCTCTGCACAACGTAATACCTCCTTTT
CCCGTCTGCTAGCTCTCATTTCGCGGTAATCCAACTTCAACCAGCAACCCGGATCTTCTA
TACGCAGTCCGGTGTGTGGGTGCATGACTGATTGGTCCGGCCGATAACAGGTGTGCTTGC
ACCCAGTGCCCAACGTCAACAAAGCAGGAACAACGGGCTGATAAGGGAGAAGATAAGATA
AGATAAGATAACAAATCATTGCGTCCGACCACAGGCCGACACATAGCAGAACGATGTGAA
GCAGCGCAGCATAGTGTTAGTGCCGGTGCAGCTACCGCTGGTATTAACAGCCACCACAAT
ACAGAGCAACAATAATAACAGCACTATGAGTCGCACACTTGCGGTGCCCGGCCCAGCCAC
ATATATATAGGTGTGTGCCACTCCCGGCCCCGGTATTAGC
Chr coordinates Chr VI from 95966-97498
w3c xhtml validator w3c css validator