Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AGX1
Systematic Name YFL030W
Strain S288c
Description Alanine:glyoxylate aminotransferase (AGT), catalyzes the synthesis of glycine from glyoxylate, which is one of three pathways for glycine biosynthesis in yeast; has similarity to mammalian and plant alanine:glyoxylate aminotransferases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AGX1 YFL030W
GTAATCCAGCCGTGATTACGATGACCAGGAAACTACAGTGAACAAGAACACTAGCCCCAG
CTTTTGCTTTCTGCTTTTTTTCTTTTTTTTTTTTTTTAGTCGTGGTTCTCTGATGGGGGA
GGAGCCGGTTAAAGTACCTTCAAAAGCAGAATGCAGGGTTATTGGAAGCTTTCTTTTTTT
CTTTTATGCTAGTTTTTCCTGAACAAATAGAGCCATTCTTTTCTTATTACTAAGAAATGG
ACGGCTTGCTTGTACTGTCCGAAGCGCAGTCAGGTTTGAATTCATTTGAATTGAATGATT
TCTTCATCACTTCATGAAGACAATCGCAAGAGGGTATAATTTTTTTTTTCTCGTTATTAT
CGCTGTTGGTGGGTTTTTTCTTTTCATATATTTCTTTTTCGCTTAGTGGTTTCTACTGTT
CTGTCTCCGGTTAGTGTGTGCTACTTCAACCGAAGAAGAAGAGGCTTTTCAAGAATGCAA
ACGTGAGGTTGGCGCGCCCTCCTACAATTATTTGTGGCGACTGGGCAGCGACACTGAACA
TAGCTCTTGAACAAGACCCTTTTTTGGCTGCAAGGAGCAAGACTGGCTGGGGTTCCACCT
CAAAGAGCCACGCTCTGCTTTTTTTCTATCTGTTTGTGTCATATCTATCTGTCTATTTAT
CTATATATATATTTTTTTATATAAAACTATAAAGAATTCTTGATGTATGCCCTTAGGTTG
GGCAGCTTTTCAACCTTAGACTTGATGCTAACGCCGCTCTGTTCCTTCTCCCGTGCTCCC
GCAAGCGAACATCTCCCCCTAACTCCGGGCCAATGAGTGATAACTATATCAAATACCTTC
GAAAGGACCTTAGTCATCATATCACTCTCACTCTCACGGCTCTCTGTAGTCCTCCTCGAG
GAGTGGCCAAGAATGTTCTGTTCCGCAGTCTTTATATAATCGCACTGGTTGAAGACGAAA
GCTCATATAATTCTTTTTCCATAGCCTAAATACACCAACG
Chr coordinates Chr VI from 76831-77988
w3c xhtml validator w3c css validator