Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TUB2
Systematic Name YFL037W
Alias ARM10, beta-tubulin, SHE8
Strain S288c
Description Beta-tubulin; associates with alpha-tubulin (Tub1p and Tub3p) to form tubulin dimer, which polymerizes to form microtubules
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TUB2 YFL037W
TATGGGTCTGCAAGGTAGAGGCGCGCTTGTTCAACAGCAGCCCCCACCGGTGTTGGTTAA
ACTCTGTCCCTTCAGGTTGACGTTCCCTTTGTCTTCCTTCTTCTGAGTGGTTTCGTTCAG
GTTTTGTTGGGACATACTTTCCTTGATTTGTCTAGCCATGGTTAAAAACGCATCCTCGAC
GTTGGTGGAGTCCAAAGCACTAGTCTCTAAGAACGGCATCTTATTCGCGTCCGCAAATTC
CTTTGCCACGTCATATTCCACGACACGCTTGTCCTTTAAATCACACTTGTTACCTACCAA
TAGCTTCAACACTGTTGAGGTTGCATACCGATCAATCTCTTGCAGCCACATCTTCACGCC
GTTGAAGGATTCTTGGTCAGTGACATCATACACGATAATGATCCCATGCGAACCACGGTA
GTAAGATGAAGTGATAGTACGGAAACGTTCTTGACCTGCAGTGTCCCAAATCTGTAGCTT
TACAGTCTTGCCGTCCAGTTCTACAGTCTTAATCTTGAAGTCCACTCCAATTGTGGAGAT
GTAGTCGTTGGTATATGTGTCGTCCGAAAACCTCAAAAGTAAACAGGACTTCCCGACACC
GGAATTCCCGATCAACAGCAGTTTGAACAGGTAATCGTACTCGCTATTCATATTAGTGCT
TTTCTTGTTTTATTTATTTCAACCTGGGCCTAACAGTAAAGATATCCTCCTCAAAACTGG
TGCACTTAATCGCTGAATTTGTTCTGGCTTCTCTTCTTTTTCTTTATTCCCCCCATGGGC
CAAAAAAAATAGTACTATCAGGAATTTGGCGCCGGGTCACGATATACGTGTACAGTGACC
TAGGCGACGCCACAAGGAAAAAGGAAAAAAACAGAAAAAACAACAAAAACTAAAACAAAC
ACGAAAACTTTAATAGATCTAAGTGAAGTAGTGGTGAGGCAATTGGAGTGACATAGCAGC
TACTACAACTACAAAAGCAAAATCTCCACAAAGTAATATA
Chr coordinates Chr VI from 56336-57709
w3c xhtml validator w3c css validator