Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TUB2
Systematic Name YFL037W
Alias ARM10, beta-tubulin, SHE8
Strain S288c
Description Beta-tubulin; associates with alpha-tubulin (Tub1p and Tub3p) to form tubulin dimer, which polymerizes to form microtubules
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>TUB2 YFL037W
ATGAGAGAAATCATTCATATCTCGACAGGTCAGTGTGGTAACCAAATTGGTGCTGCATTC
TGGGAAACTATCTGTGGTGAGCACGGTTTGGATTTCAATGGGACATATCACGGCCATGAC
GATATCCAGAAGGAGAGACTGAACGTGTACTTCAACGAGGCATCTTCTGGGAAGTGGGTT
CCAAGATCTATTAACGTCGATCTAGAACCTGGGACGATTGACGCAGTACGCAATTCTGCC
ATCGGGAATTTGTTTAGACCTGACAATTATATCTTTGGGCAAAGTTCTGCGGGCAACGTG
TGGGCCAAGGGTCACTACACAGAAGGTGCTGAGCTTGTAGACAGCGTCATGGATGTTATT
AGACGAGAGGCCGAAGGATGCGACTCCCTTCAAGGTTTCCAGATCACACATTCTCTTGGT
GGTGGTACCGGTTCCGGTATGGGTACGCTTTTGATCTCGAAGATTAGGGAAGAGTTTCCT
GATCGTATGATGGCCACCTTCTCCGTCTTGCCCTCTCCGAAGACTTCTGACACCGTTGTC
GAACCATACAATGCCACGTTGTCTGTGCACCAATTGGTAGAACACTCTGATGAAACATTC
TGTATCGATAACGAAGCACTTTATGACATCTGTCAAAGGACCTTAAAGTTGAATCAACCT
TCTTATGGAGATTTGAACAACTTGGTCTCGAGCGTCATGTCTGGTGTGACAACTTCATTG
CGTTATCCCGGCCAATTGAACTCTGATTTGAGAAAGTTGGCTGTTAATCTTGTCCCATTC
CCACGTTTACATTTCTTCATGGTCGGCTACGCTCCATTGACGGCAATTGGCTCTCAATCA
TTTAGATCTTTGACTGTCCCTGAATTAACACAGCAAATGTTTGATGCCAAGAACATGATG
GCTGCTGCCGATCCAAGAAACGGTAGATACCTTACCGTTGCAGCCTTCTTTAGAGGTAAA
GTTTCCGTTAAGGAGGTGGAAGATGAAATGCATAAAGTGCAATCTAAAAACTCAGACTAT
TTCGTGGAATGGATCCCCAACAATGTGCAAACTGCTGTGTGTTCTGTCGCTCCTCAAGGT
TTGGACATGGCTGCTACTTTCATTGCTAACTCCACATCTATTCAAGAGCTATTCAAGAGA
GTTGGTGACCAATTTTCCGCTATGTTCAAAAGAAAAGCTTTCTTGCACTGGTATACTAGT
GAAGGTATGGACGAATTGGAATTCTCTGAGGCTGAATCTAATATGAATGATCTGGTTAGC
GAATACCAACAATACCAAGAGGCTACTGTAGAAGATGATGAAGAAGTCGACGAAAATGGC
GATTTTGGTGCTCCACAAAACCAAGATGAACCAATCACTGAGAATTTTGAATAA
Promoter Sequence
Download FASTA
>TUB2 YFL037W
TATGGGTCTGCAAGGTAGAGGCGCGCTTGTTCAACAGCAGCCCCCACCGGTGTTGGTTAA
ACTCTGTCCCTTCAGGTTGACGTTCCCTTTGTCTTCCTTCTTCTGAGTGGTTTCGTTCAG
GTTTTGTTGGGACATACTTTCCTTGATTTGTCTAGCCATGGTTAAAAACGCATCCTCGAC
GTTGGTGGAGTCCAAAGCACTAGTCTCTAAGAACGGCATCTTATTCGCGTCCGCAAATTC
CTTTGCCACGTCATATTCCACGACACGCTTGTCCTTTAAATCACACTTGTTACCTACCAA
TAGCTTCAACACTGTTGAGGTTGCATACCGATCAATCTCTTGCAGCCACATCTTCACGCC
GTTGAAGGATTCTTGGTCAGTGACATCATACACGATAATGATCCCATGCGAACCACGGTA
GTAAGATGAAGTGATAGTACGGAAACGTTCTTGACCTGCAGTGTCCCAAATCTGTAGCTT
TACAGTCTTGCCGTCCAGTTCTACAGTCTTAATCTTGAAGTCCACTCCAATTGTGGAGAT
GTAGTCGTTGGTATATGTGTCGTCCGAAAACCTCAAAAGTAAACAGGACTTCCCGACACC
GGAATTCCCGATCAACAGCAGTTTGAACAGGTAATCGTACTCGCTATTCATATTAGTGCT
TTTCTTGTTTTATTTATTTCAACCTGGGCCTAACAGTAAAGATATCCTCCTCAAAACTGG
TGCACTTAATCGCTGAATTTGTTCTGGCTTCTCTTCTTTTTCTTTATTCCCCCCATGGGC
CAAAAAAAATAGTACTATCAGGAATTTGGCGCCGGGTCACGATATACGTGTACAGTGACC
TAGGCGACGCCACAAGGAAAAAGGAAAAAAACAGAAAAAACAACAAAAACTAAAACAAAC
ACGAAAACTTTAATAGATCTAAGTGAAGTAGTGGTGAGGCAATTGGAGTGACATAGCAGC
TACTACAACTACAAAAGCAAAATCTCCACAAAGTAATATA
Chr coordinates Chr VI from 56336-57709
w3c xhtml validator w3c css validator