Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LAM5
Systematic Name YFL042C
Alias LTC2, YFL043C
Strain S288c
Description Putative protein of unknown function; YFL042C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LAM5 YFL042C
CACATTTTCATTCGAGGGGTGGATATCAACCTACTTAACTGTTCCACCGTTCTTGACACA
TTTTAGCATATTCTCAACGCTCTTTTGAGTACCTGAGGACTCGAATCCATCAGGCTTCCT
TTTTTTCTGATTATAGCAGTTCTTCATAGCGTTTATAAACTGTCCATTTTGCTCTTTCTT
GGAATCATGTGTACTCATGAACACCAAACCCTCTGAGTACCGCACCCGCCAGCAGATCAA
TTGTTCCAGCACCTATAACTACAGCTTACTCCCCACACTTCAGCTAGGACGGCCTTACTA
CATGGAGAGCGACAAATAGTGGCATCTACAGAGGACTCTTGCTAGAAATTCACTGTAACG
GTAATCAGTAAACGCAGTCGACGTTAACCACGAACTCTTGACAAAGGGTGCCGTCACGGT
CAGTGATGCAGCAAATGGTATGTTGAGCTGCAAACTATAATGGCCTCACAGAAACTCTTT
GGTAAACCTATTTGGGTATGAGGGCTATATGCTTACTGCATCACCCGCTTTACAGTAGTT
TGAGATACTTCAATTTCAAGAACAGCACCGTTGGATTCGTGGCCCAAAGTCATGGGCTTC
CCAGGTTACTTTACGCTGACCTGGCCATCCGTGTAGTAGTGAATGTCTGATCCGCAGATT
CCAATAGCCTTCACTTAAACTTTGACCTGTGACATCACGTTGGCTTGGCAACTTTCTGAA
TCTCTTTCATGTTTGGTTCAAAACATTTGATAGCTTTCTGCATTGTGTTGAGTGGAGGTC
AGAAGGTCAGATATTACCAATTACCGTCATCCTCAATGTCACTCATGATAGAATGTTTGC
TTTATGTCTGAGATCAGAGAGATCGCGTATCGCTGAGCAGGGGGACTTGTTTCTCCCACC
CTTTTTCATAAAGCATCTTGACAATTATATTAAAACACTCAACCATTTCGCTATCTGAGA
AAAGGGTGAAGAAGGCAACTACACAAAAAGATTAGTGGTG
Chr coordinates Chr VI from 47744-45720
w3c xhtml validator w3c css validator