Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RGD2
Systematic Name YFL047W
Strain S288c
Description GTPase-activating protein (RhoGAP) for Cdc42p and Rho5p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGD2 YFL047W
CATTAAAAAATTGCATTTTGAATATTTCAAAAGACTCTGCATTATTATTCACTGCTCCAT
TTTGAGCGGTGACACCAATACGGTAAGACCCAGAGGGAAAGCGAACCTTCCTAGTTTGGA
AACAGACTTTATTGTCCACCTGAACTTTTAATAAGTTGTCGTCTTCCAAATCATAAGTTA
CTCTGATCGTGGAAGGAACGGAGGAATCCTGATAACCCATCAAACAAGATGCAAAACTCT
GATCATAGATTTTCGTCTTATCTACAGGCTTTTGACCATCATTTAGTTGACCACGAAGTG
TTGGGCCCAATGGACCATTGTTATCCACTAATAATTGTAAACCATCATAGTTCACTGGCC
CATTGTATAACTGCTTATCGCGTGGTACGTTAGAATCTTGAACAAACCAAAATGATATGC
CACCGTCGGTTTGGCCAGAATAACCAACACTCCTAAATGTCCACTCCATAGTAAAAGAAT
CCTTCAAATCGAATCCTTGCTTCAACCAAAGTGAACCCTTGGAATTTTGCTTAGAAGTCA
ATACAATTCTCCCTTCCTCTAGACTAGCTTGTTCTCCAGTTTGCCAGTTATTGGGCACTT
TACGTGCATTAATGAGATCAGGGAGCGAGTAGTCTGAGCTTAATTTGGATGCATCTGAAG
TGTCACCCAATGGATGAGCTTCTAGCAATCCAGCCCATGTCGCTAAGACGGTAAAAACAC
TCAACAGTACTGTACTTTTCATAGTAATTAACATCATCATAAAATACAAATTCCCTGATG
CTAACTATTTGTTAATTTTATTGGTATAATTATAATTATTCAATACCAATTAAGGCTTCT
ATTAAAAGATCAAAAACATTCTTAAGAGTTCATACTGTTTCTCTACTCGTGTATAGTGAT
ACCAAGACGTAATGACAATAATAGATGGAAATTGAAATATTATGAAACAGGAATAATATT
CCGTTGAATTGTAATAGATGTTGTACACCTGCAAGCGAGC
Chr coordinates Chr VI from 40421-42565
w3c xhtml validator w3c css validator