Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ZNF1
Systematic Name YFL052W
Alias ROP1
Strain S288c
Description Putative zinc cluster protein that contains a DNA binding domain; null mutant sensitive to calcofluor white, low osmolarity and heat, suggesting a role for YFL052Wp in cell wall integrity
External source Open in SGD external link
Orthologs
Yarrowia lipolytica CLIB122YALI0_C07821g
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZNF1 YFL052W
CGACTAACCTTTTTCTTGGCAGTATGGAGACTGACTAGGTCTCCCAAACATTCATTGTAA
CTGCTGTTTAAAGATTTTGTTCTAACCTAAATTCAAGTGAGAAGCTGAACATGTGTCTCT
ACTTATGATATCACGACAGCAAATACTAATCTTGCCATAAATAGTCTAGCGTTTTGCAAC
TTACCTCTAGATATATTTTATTTCTTGAGGAACCGTTTTCGTCGGTAATAACAAAATACT
ACTGAAACGCCACAGCATTGAGAGAATACGTTATCGATTACGGCTTTCTTCTCGCTCCAG
ATGTCGCGGGTAAGATATTCACCTCAAACTTTTCTTGTTGAGTGTCGTCACAAATCTAGA
ACCTACATGCCATCTCAACGATTTTTCTGGAGAAAGGCCTCACTCCGTTCCGTACGTAAT
GCATAGATAAAGTATCAGGATCTTCACGATGCTCGAGAGTTACTTAGTAGTCTGAGTTTA
TGCGAAAAAAACTCCGCCGTTGTAATAATCGGGAATACACAGAAGTAGTACTGCACTATC
ACTGGGATACTCAAAAACCTTCTTTTTAACTTTTCTATCCCACAAATAGAACATAGGAAA
GAACATTGACTCCTCCACTTGAAGTTAAATTACAGGAACAAACGCCTAACTATAATTTCG
ACATTGTTGCATCAACGAATCGACCGAAAGAAAAATCTGGAGTTGCAGTTATCACTTGTA
TGTGCACTAAGATTTATATTTTTACTCCTGAGATCTGCCAAATCGGTAGCTTATTGAACT
GCGTTCCTTTTTCCCCTGAGTTCTCGAGGTACCTGCGGCTTTGTCTGTGCCATCTCCCCC
ACTTTAAAGTACCCCACGTTACTACCGCGTTTTTCCCCACCCCCGGCTTAATAAATTAGC
TATATCTTGTTGACTTAAATACGGAGAAAAGAAGAAAACCTTCAAGAAATGCTTCATTGT
CTTGTCAAAAGAGCTAAAGTAAAAGAGCTCTAGTTCGAAG
Chr coordinates Chr VI from 28232-29629
w3c xhtml validator w3c css validator