Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ZNF1
Systematic Name YFL052W
Alias ROP1
Strain S288c
Description Putative zinc cluster protein that contains a DNA binding domain; null mutant sensitive to calcofluor white, low osmolarity and heat, suggesting a role for YFL052Wp in cell wall integrity
External source Open in SGD external link
Orthologs
Saccharomyces sp. 'boulardii' biocodexKO01_05483
Yarrowia lipolytica CLIB122YALI0_C07821g
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ZNF1 YFL052W
CGACTAACCTTTTTCTTGGCAGTATGGAGACTGACTAGGTCTCCCAAACATTCATTGTAA
CTGCTGTTTAAAGATTTTGTTCTAACCTAAATTCAAGTGAGAAGCTGAACATGTGTCTCT
ACTTATGATATCACGACAGCAAATACTAATCTTGCCATAAATAGTCTAGCGTTTTGCAAC
TTACCTCTAGATATATTTTATTTCTTGAGGAACCGTTTTCGTCGGTAATAACAAAATACT
ACTGAAACGCCACAGCATTGAGAGAATACGTTATCGATTACGGCTTTCTTCTCGCTCCAG
ATGTCGCGGGTAAGATATTCACCTCAAACTTTTCTTGTTGAGTGTCGTCACAAATCTAGA
ACCTACATGCCATCTCAACGATTTTTCTGGAGAAAGGCCTCACTCCGTTCCGTACGTAAT
GCATAGATAAAGTATCAGGATCTTCACGATGCTCGAGAGTTACTTAGTAGTCTGAGTTTA
TGCGAAAAAAACTCCGCCGTTGTAATAATCGGGAATACACAGAAGTAGTACTGCACTATC
ACTGGGATACTCAAAAACCTTCTTTTTAACTTTTCTATCCCACAAATAGAACATAGGAAA
GAACATTGACTCCTCCACTTGAAGTTAAATTACAGGAACAAACGCCTAACTATAATTTCG
ACATTGTTGCATCAACGAATCGACCGAAAGAAAAATCTGGAGTTGCAGTTATCACTTGTA
TGTGCACTAAGATTTATATTTTTACTCCTGAGATCTGCCAAATCGGTAGCTTATTGAACT
GCGTTCCTTTTTCCCCTGAGTTCTCGAGGTACCTGCGGCTTTGTCTGTGCCATCTCCCCC
ACTTTAAAGTACCCCACGTTACTACCGCGTTTTTCCCCACCCCCGGCTTAATAAATTAGC
TATATCTTGTTGACTTAAATACGGAGAAAAGAAGAAAACCTTCAAGAAATGCTTCATTGT
CTTGTCAAAAGAGCTAAAGTAAAAGAGCTCTAGTTCGAAG
Chr coordinates Chr VI from 28232-29629
w3c xhtml validator w3c css validator