Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AAD6
Systematic Name YFL056C
Alias YFL057C
Strain S288c
Description Putative aryl-alcohol dehydrogenase; involved in oxidative stress response; similar to P. chrysosporium aryl-alcohol dehydrogenase; expression induced in cells treated with the mycotoxin patulin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AAD6	14318463 upstream sequence, from -1000 to -1, size 1000
TCACTTGCAGCCAGTAACCAGACTCCTATAGCATTAAGTCCATCGCTTTTTGTAGCATTG
TTTTGGCCAAGTTTTGGAACGTGGTATAATAGGCTCAAGGATTTTGAAATCATATTTTGG
CGATGCTAAAGAGAGACATATGCTAAAGAGAGACATAACGTGAACCTACTACTCTTCTTT
GGTTTCACATTGTTAATGAAAAGGATTCTATGTGGGAATCAATAAAAAATAATAAAAAAA
AGATGGCAGAAAAGAAGTGCGCAGGAGCACATATTTGGTGAAAGCGTGACTTTAATCAAG
GGCTAAGTAATTGATAATCGCAATCATCCGGCATTTAATTTTCTATGTACAAAATTGTAG
AAAATGATACACCGACCTGTTCTCAAATACAGTGCTAATAATCACATGGTTCGTAGAGGG
CGTGAACAGGAGAAGGAGCTGGCTTGTCGAGTTTAAAATGTGCGTACAGGAAGCCGTAAA
GATCTATATTGCATCTGCTTGCCTTGCTGGTTTTAAAAAGCAAAACAACGCACGGATTGA
TAACAATATTTAGACTTTCTGGTTTGCCACCGCTCCTATAGAATCTTTAGCCTTTTCAAA
TGGAATCTGAAAGAATTACTAGGATGGAGTAACGCAAAATGAACTTTGATATTACGAAGA
GATAGTACCGTTCCGAATCAACACAGGTTCTTGCAGTTTTGTTGTGGAAACCGTAGAACA
TGCAGTGGCTAATTCGTAAGCCAATTTTCACATTTCGCTTACTAATTTTGCTCTCAATTA
GTAAGCAAATCCGTATCGAAGGTATACAACCACGTTCACCGTTTTCACGTGCACAAATTC
GAGAAAATAAGCACTCAATCTTCAGACATATAAAAGGAGCAATACCGTCGCAATGAGAAA
CAATTTCCTCTCTGTTCAACCTAAATCAGTCAATCAATCGATATAAATTCAGTACTAACT
GAATATCTCTTCTATATCATTTTCAATAGCGATTTTTAAT
Chr coordinates
w3c xhtml validator w3c css validator