Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name THI5
Systematic Name YFL058W
Strain S288c
Description Protein involved in synthesis of the thiamine precursor hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>THI5 YFL058W
CGTCCCTGTCGACTTGCTGAAGACAACACTATCAGAGGGAAAGCTACCTGTAGTCAATTT
TGCTGCTGGTGGAGTTGCTACTCCAGCAGACGCTGCTCTATTGATGCAATTGGGTTGTGA
AGGTGTTTTCGTCGGCTCAGGTATATTCAAATCGTCAGATCCTGAGAAGTTAGCATGTGC
TATCGTTGAAGCCACGACTCACTACGATAACCCAGCAAAACTATTGCAAGTTTCCAGCGA
TTTGGGTGACTTGATGGGTGGTATTTCCATCCAATCAATTAATGAAGCAGGAGGCAAAAA
CGGTGCAAGACTTTCTGAAATCGGATGGTAGAACTAGCGATGCTCACACAACGCTAATTT
GTTTCCTTCGAAGGGGCAGTCGGCTATTGTAGTTTCTATATATTATGTAGCACAACATGG
AAACCATATTCAGCCAGTTTGTATATATGAGAATTAAACGTTAAAACTTTTTCATCCTAT
CAGTCTTTCACATTGGCCTTGCCTAAAGGGCACAATCGTTCACGTATATACATATGTATG
TTTACGTATATATATATGTGTTTACAAATATGCATGTATATTCTTTTCGAGGAAGATTAT
TATATGCTATTAGGCGATGAGTCGGCTTAATTTTTTAGGGGGACGAGATTGGCGCGTTAG
TGCATAAAGACAGCAAATCACCTGGAGGTGACAACATTAATGCATTTATCGGTTTTTGGC
TATGATGCAATGAGTACAGTTCCAATTGAACGGCTCATGAACTATGAAATATACGAATTA
TTCAACTAGCAGAAGGCTTGAAATATTACTTATTCAGATTATGAAAATGGTGCTGTTATA
GCAAAATAAGCAACATCAATCTCTTGCGACGACAGCAAACAAAACATATAAAAACCTCGT
ATTATCATCTTCATGAACAATATTCTTGTCCATTCTTTTGTTCTTTTACCTTTTCAATTT
TATAAAAATACCACAACAACAATAAACACACTTCCAAGCT
Chr coordinates Chr VI from 12929-13951
w3c xhtml validator w3c css validator