Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YFL068W
Systematic Name YFL068W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YFL068W YFL068W
GATCTCGCAAGTGCATTCCTAGACTTAATTCATATCTGCTCCTCAACTGTCGATGATGCC
TGCTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCATGGAACGCA
AACGCTGAAAAACTCCAACTTTCTCGAGCGCTTCCACAAAGACCGTATCGTCTTTTGCCT
CCCATTCTTCCCGGCACTTTTTCTCGTCCCAGTTCAAAAAGTACTGCAGCACCTCTGTCT
TCGATTCACGCAAGTTGCTCCATACTTTATAATACAACTCTTTGATCTGCCTTCCAGACA
TGCGGAAAACTTGGCTCCCTTGCTTGCCTCTTGTCGAATCCAATACACTAATTGTTTCTC
TTCTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTAGATCTCTC
CCCTTTTTACGCTAAAAAATTTCAAATACCCTACAGGGTCCCCATGATATGGCTCGATGT
CTTCCAAGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGCTAGTGCTT
CCCAAGCCATCCTCCGATACGATACTTTCTGGCCAGCCCAACAGACACAGAGCTCGAACA
TCTTTTGACAGCCCTTGCATAATCCGTATTGTGTGAATACTCCCTCTGGGCAGAAGTATA
CGTCAATACCATAGAGGAAAAGATGTTTAATTTCGTCAGACCGAAATCCAAGAAACTGTA
AGACATTCATATTCTCGGAAGTATTGGGAAATTGTGCTTTCAGTTTCTTTCTCTCTAGCA
AAACCATTTGACTCCCTTTCCGCTTATACGACTCTTTGTTAATGTCGGTGACTGGATGGA
ATCTATTATCCTCAGCATTGCCATCTTTATTGGCGTCCTCCTTGGCACTAGCGTTGGTGC
TGGCAGTGGTAGTAGCATTAGTCCTGACGTTGATGCTGGCAGTGGTAGTCGCACTAGTCC
TGACGTTGATGCTGGCAGTGGTAGTCGCATTAGTGCTGGA
Chr coordinates Chr VI from 53-535
w3c xhtml validator w3c css validator