Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DCV1
Systematic Name YFR012W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DCV1 YFR012W
GCACCCCCATATTTCTCCAACTTTTGTAACTCTAATTGATCAAATAATGTTAGTTTCTTG
TTCAACGACTCGATTTGATTATTCAATGAACTTGATGATATTCCATCAACGGCATCCTTG
TCGTCGTCTGATAATAGTGAATTGTTCAAAGTATCTTCAAACTTCTTTAACGTTTCAACT
TCTAGGTTAGATAGCCTTTGTGAAACCTTCTTCTCAATGAACTTTTCTGCATTTTGCTTG
GTGACATAGTCTGATTCCTTCGATGAATCCAATTGAGAAACCAAAGACTGTGAAAAATCG
ATCTGTGTTAGCGGAGTATAGACTTGTTGTTTTTCTGCACCAGCACCCACTTTGGAAGTG
TTTGAACCCATGATTGACTCTGTATTAGTCGATATACCACCTTGTTTTTGTTCTTGAATT
TTTTTTTGATTAGCAATCTCTTTGAAATGTTCCTCCTCACTTGTTTTTTCCTCTGCGTCT
CATTGGAAGAAGAAATATATATATATGCGACATACCACGAATATTCGTAGTTTTTTACAA
CAAAAACGACTCTCGGTAGCCAAGTTGGTTTAAGGCGCAAGACTGTAATTTACCACTACG
AAATCTTGAGATCGGGCGTTCGACTCGCCCCCGGGAGATATTTTTTTAAATCTTGCAGCT
TTCAATATTTAAATATAAGTAATAAACCATCAGTTAAACAACAGAACAAGTATTTCTTAA
ATCTCATGAAAAATCTAATAATGTTATTTGCCGAATTTTATTATTGATTTGGTTGGTCTT
CTTGATAATTCTGTGGGCGCTTTTTTTGTGACATATTAAAATTGCGAAATTGCAAACGAA
AATATAAATATATATGAATGTTAATAAATAAATTATTTAATTGATGATTGAGGATGAAAT
ACACTTTTATGATCTGTCCTTACGCGTAATAATTACAAGAAGGTGAGAAAATTGCCTTTT
TTTGCTAATTTTTTTTTTTTGGTACCATATTCAATAATTG
Chr coordinates Chr VI from 167888-168496
w3c xhtml validator w3c css validator