Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IGD1
Systematic Name YFR017C
Strain S288c
Description Cytoplasmic protein that inhibits Gdb1p glycogen debranching activity; required for normal intracellular accumulation of glycogen; phosphorylated in vivo; expression increases during wine fermentation; protein abundance increases in response to DNA replication stress; IGD1 has a paralog, YOL024W, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IGD1 YFR017C
TAGTGCTCGCTGCTCATTATGATACCAAGATAGCGCCCACGGGGATGGTGGGCGCTATCG
ACAGTGCCGCCTCGTGTGCCGCGCTGCTATATACGGCCCAGTTCCTAACGCACATCGCGT
GCCACGAGCGCACGAAAGAGTACAATGACTTAGAGTCGAACACTGTAGTATCGAATTCTA
CCTTGGGTGTAAAGATCGTATTCTTTGATGGAGAGGAGGCCATTGAAGAGTGGGGCCCCG
AGGACTCGATTTATGGAGCACGCCGATTAGCCGCCCAATGGCTTGCTGACGGCACGATGA
CAAGAATTCGCCTATTATTTCTTCTGGATCTTTTAGGAAGTGGCGAAGAGGAGCCGCTAG
TGCCCAGCTACTATGCAGAGACACATCAAGAATATCAGCTGCTCAATCGAATAGAGGATG
ACTTGTTATTTCGACGTGGAGATGAAATCAACGGCGAATCGGCATTAGCCGCCGAAGTCG
CGCGTCAACGCAAACATCTGGACCCCACGGACTATCGATTTTTAGGGCTCGGGCATTCGG
TCATCGGAGACGACCACACGCCATTCCTGGCCGCCGGAGTACCCGTATTACATGCAATCC
CGCTACCATTCCCAAGTACATGGCACACCGTGGATGATGACTTCCGGCACTTAGACGCCG
CGGAGACTCGTCACTGGGCGCTGCTTGTGTGCGAATTTGTAGTACAGTCACTACGCTCCC
GTAACCAGTGATAAATCCCCTGTTTCCTTTCGTTAACATCTCCCCCTGATCTGGGGGATG
TGGGGTGGAATGAGTGGCCCGGTCAATGTCAGTGCACCACTCTGAAAAGCTTGCACACAT
ACATATACATATATATATATATATATGTAGGTATAGTAAAGGTTTGCCTGAGTAATTTTT
GCGCGAGAGATCTACTATCAGCAGCGATGAGAGCAGCTACATAACACATAGTAAATCACA
CATCTACGCAACACACACACACACGCATACACTCACCCTC
Chr coordinates Chr VI from 182861-182274
w3c xhtml validator w3c css validator