Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET10
Systematic Name YFR030W
Strain S288c
Description Subunit alpha of assimilatory sulfite reductase; complex converts sulfite into sulfide
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>MET10 YFR030W
ATGCCAGTTGAGTTTGCTACCAATCCTTTTGGCGAGGCCAAAAATGCAACTTCACTGCCA
AAATATGGTACACCCGTAACTGCCATTTCATCTGTGCTGTTCAATAACGTGGACTCCATT
TTTGCTTACAAGTCCTTTTCTCAACCCGATTTGCTACACCAAGATCTAAAAAAATGGTCT
GAAAAGCGTGGTAACGAATCACGTGGGAAGCCATTTTTCCAAGAGCTGGATATCAGATCT
GGCGCTGGTTTGGCTCCTTTAGGGTTTTCTCATGGATTGAAGAACACTACAGCAATTGTT
GCTCCAGGGTTTTCGCTGCCATACTTCATTAACTCTTTGAAAACCGTCTCTCATGATGGT
AAGTTTCTTTTGAATGTTGGTGCTTTAAACTACGACAATGCTACCGGCTCTGTCACCAAC
GATTATGTAACCGCATTGGATGCTGCTTCCAAGCTGAAGTATGGTGTCGTGACTCCGATT
TCCGCTAACGAGGTACAAAGTGTCGCCTTACTGGCATTGGCGATTGCCACTTTCAGTAAT
AACTCCGGAGCTATCAATTTATTTGACGGATTAAACTACTCGAAAACCGTCTTGCCGTTG
GTCGAATCTGTTCCTGAGGCATCTATTTTGGCAAAACTATCCAAAGTTATTGCACCAGAT
GCTGCCTTTGATGATGTCTTGGATAAGTTTAATGAATTGACTGGATTGAGACTACATAAT
TTCCAATACTTTGGTGCTCAGGATGCTGAAACTGTGTTTATCACTTATGGGTCTTTAGAA
TCCGAATTGTTCAACTCTGCGATTAGTGGTAATAATTCCAAAATCGGGTTAATCAACGTC
AGAGTGCCATTACCTTTTAACGTTGCTAAGTTTGTCACTCACGTTCCATCCACTACCAAA
CAAATTGTTGTTATAGGCCAAACTTTGGATGGTTCTTCGCCTTCTTTCTTGAGATCTCAA
GTTTCAGCCGCCTTATTTTACCACGGCCGCACCTCAATTAGCGTTTCTGAGTACATCTAT
CAACCAGATTTCATTTGGTCCCCAAAAGCTGTCAAATCAATTGTATCGTCATTCATCCCT
GAATTCACTTACAATGCCGATTCATCTTTCGGCGAAGGATTCATTTATTGGGCCTCTGAT
AAGAGTATCAATATTGATGTTGCCTCCAAACTTGTGAAAGCTCTGTCTTTGGAAGATGGG
AAATTTGTGTCTTTGAGAACGAAATTTGATAACTTGGCTAATGCTGGTACCTTCCAAGCT
CAATTTGTGACCTCGAAAGAACAGATACCTGTTTCAAACATCGATTCTACGAAATTATCA
GTCGTTGAAGATGTCAGTTTATTGAAGCATTTAGACGTAGCTGCTACCGTCGCAGAACAA
GGTTCAATTGCGTTGGTTTCCCAAAAGGCAGTTAAAGATTTGGATTTAAATTCTGTAGAA
AGTTACGTCAAGAATTTGGGAATTCCTGAATCATTCCTAATATCTATTGCGAAGAAAAAC
ATCAAATTGTTTATCATCGATGGTGAGACCACTAACGACGAGTCCAAATTGTCCTTGTTT
ATCCAAGCCGTTTTCTGGAAATTGGCCTTCGGTCTAGATGTCGCAGAATGTACCAACCGT
ATCTGGAAAAGCATTGATTCAGGTGCAGACATTTCAGCAGCCTCGATTTCTGAATTTCTC
ACTGGTGCATTCAAAAACTTCCTCAGTGAGGTTCCGCTAGCGCTGTACACTAAATTTTCT
GAAATAAACATTGAAAAGAAAGAGGATGAGGAAGAGCCTGCAGCTTTACCAATTTTCGTT
AATGAAACATCTTTCCTCCCAAATAACAGTACCATTGAAGAAATACCATTACCTGAGACC
TCTGAGATCTCTGATATTGCCAAGAAGTTGTCCTTCAAAGAGGCATATGAAGTTGAGAAT
AAACTAAGACCCGATTTACCCGTCAAGAACTTCGTCGTGAAAGTTAAAGAAAATAGACGT
GTTACGCCTGCTGATTATGATAGATATATTTTCCATATTGAATTCGATATTTCTGGTACT
GGAATGACTTATGACATCGGTGAAGCCCTCGGTATTCATGCCAGAAACAATGAATCTTTG
GTCAAAGAATTCTTAACCTTCTATGGTCTAAATGAATCCGATGTTGTCTTAGTCCCCAAC
AAGGACAACCACCATTTGTTAGAAACAAGAACCGTCTTACAAGCATTTGTGGAAAATTTG
GATATTTTCGGTAAACCACCAAAAAGATTTTACGAATCATTGATTCCATATGCCTCTAAC
GAAGAGGAGAAGAAAAAATTAGAGGATTTGGTTACTCCTGCCGGTGCAGTAGATTTGAAG
AGATTTCAAGATGTGGAGTATTATACATATGCTGACATTTTTGAATTGTTCCCATCTGTT
CGCCCATCTCTTGAGGAACTTGTTACTATCATTGAACCATTGAAGAGAAGAGAATACTCA
ATTGCCTCCTCTCAGAAAGTTCATCCAAATGAAGTTCATTTATTGATCGTTGTTGTTGAT
TGGGTGGATAATAAAGGAAGAAAAAGGTACGGTCAAGCTTCTAAGTATATCTCAGACCTT
GCTGTCGGTTCAGAATTGGTCGTTAGCGTTAAACCATCTGTTATGAAATTACCACCATCT
CCAAAGCAACCAGTTATTATGAGTGGTTTAGGTACTGGTTTGGCACCATTCAAGGCCATT
GTTGAAGAGAAATTATGGCAAAAGCAGCAAGGTTATGAGATTGGTGAAGTCTTCCTATAT
CTAGGTTCAAGACACAAAAGAGAAGAATATTTATATGGTGAGTTATGGGAGGCTTACAAA
GATGCAGGTATTATCACACACATCGGCGCTGCTTTCTCAAGAGACCAACCTCAAAAAATT
TACATTCAAGATCGTATCAAAGAGAATTTGGATGAATTAAAAACTGCAATGATTGATAAT
AAAGGTTCATTTTACTTGTGTGGCCCTACTTGGCCAGTTCCAGATATTACTCAAGCTTTG
CAAGACATTCTGGCTAAAGACGCCGAGGAAAGAGGCATCAAAGTCGACTTGGATGCCGCA
ATTGAAGAATTAAAGGAAGCATCAAGATACATTTTAGAAGTCTACTAA
Promoter Sequence
Download FASTA
>MET10 YFR030W
CCCCACCAATCACCATAACACTTCCATACAGAGATCCCATCAATACCATACAACTTTCGC
ACGACGCCAAGTATCTGACATGTTCGACCGCGCTAGAGTCGCGGTTCTTGATCATATCTT
TGCAGAAAATAAACGAACCAAGACTGATAATGAAAAGTGTTCGGTCCATAGACACTTCCT
TAGAATCTGAAGGTATCACTGACACAAAACTTTTCCCAGGAAATCCAAATCTGATGTGTA
TCACATCAACAGCATTCAATTCATCTCCACTGGTCATAAACACCAAAATCACCCAAATTA
ACGGTGTACGGACCGTGGCACAACCATCCATGCTTATAAGGGTAGATGAGATTGGATGCA
AGATTCACAAGTGCGAAATATCACCAAGAAACGACGCAATTGCCTTCCTCGACCGCAACG
GATCAGTTTACATCATGTGTGCCCCCACCATGATGGACAACAACGAAAAAAGAAGGACAA
TCCTCGTTGAAACCGTGGCAAATGCCTACAGGGCTTATGAATCAGCTACTTTGCGGTTTA
ACCCAGAGGGCAACAAGCTTTATATTCTCGACAGAAAGGGGACTTTCTTTGTGGAAGACT
TTGCATATGGCTTGCCCCAATCTCGCGAAATCACCAAATGTAAGCAAATATTCCACAAAT
AATGCATCTAAATATATACGTATGTTTAAGGTTCTGGTATACAGGTATTAAAAGAAAACA
CTATCAACATTCCCAATAAGATATACCACACCACGTGAGCTTATAGAAGCACGTGACCAC
AATTCACCCCACAGGTGTGGCTTTTTTGGTGCCGTAGAAAAGACTCATTCATGAATCGTC
GGAAACCCATAGTCATCTTCGAGCAAAAGGTATATATAAGCAACAGAGGGCAGTAGTTCT
CGAGACCACCATCTTTTGATTGGAAATAGTTTCGTTTAGATGGGGTGCACATAGTTTTTT
TCAACTGCTTTTCCTCGAGGTCACCCAAATATACAACGAG
Chr coordinates Chr VI from 213312-216419
w3c xhtml validator w3c css validator