Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ERJ5
Systematic Name YFR041C
Strain S288c
Description Type I membrane protein with a J domain is required to preserve the folding capacity of the endoplasmic reticulum; loss of the non-essential ERJ5 gene leads to a constitutively induced unfolded protein response
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERJ5 YFR041C
GGAAATTCCTAATGAAATGCCCCTCGAACAAATAATTAGGAATTTGCAAAGTGCAAGGCT
AAAATATAAGTCTATCGAGAATAGTAGTGAAGCTGATGCTTTTGCAAATGAAATGGCTGA
CGAACTATCCAGATATTTATGAGTATGTACAGATATGTATATGTGTATACATATGTATTA
AACCAATAAGATTGCTCATTTTGTTAATAGTTTTTTGTATGCTGTTAGTAGTACAGGGAA
GTATGCTAGTAAAACCACCCTGTTGATTATGTCCAAAGTCGGGGTAGAATGATAGTTCTT
AACCTGGATATTTAATAGTAGCAATGCAAATTCACTCAGGTAGAGAATTGGCAATGTAAC
AAATGTGTTAACCTTCCATACAAGTGTTCTTTCCTTTACGCCCTTACGTTTAAAAAGTTT
GCACCAATGGCAATATGCCTGTGATAAAGATAAGGAAATAATGAAACTAGAATATGATGC
ATTCTTGAGGATCAATGCATGCTCATAATCGTCATAAAAATGGATCACGCTGACTAAATA
GATAAAATTTAGGTCTTTCAAAAACGTTCTTGAAAGCAAACCATATTTGAACCCGTGGAA
TCTAAGCAACCAAATAACTTCCATGATGCTGGAATAAAACATCAAATATATCAAGAATTC
GTGGATTCCTCCCGGTAAAAACCGAGACCCTACCAGTGGCATTAATATCAGCCACCGTAT
CAATAATGCAGCATACAAAAAGCTTGTGGCTAATTGATAATACTGATAAAGCTTATGCGT
CAACTTGATACCTGCCATCCTCAATGCTAGTTAAATATATGTGACCGAACAAATACTTTT
ATTGACGTTGTATTTACATTATTTCCCAATTTGAAGGTAAATCATATTTAATTTCCATAT
TCAAAATTAATAATCACGAAAAAAATGAGATTTTCAAAATAACACGTACCAAAAGAATAG
AAAACGAACAAAAAATCAAGGTTACAAGATCACTAAAAGA
Chr coordinates Chr VI from 238255-237368
w3c xhtml validator w3c css validator