Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IRC7
Systematic Name YFR055W
Strain S288c
Description Beta-lyase involved in the production of thiols; null mutant displays increased levels of spontaneous Rad52p foci; expression induced by nitrogen limitation in a GLN3, GAT1-dependent manner and by copper levels in a Mac1-dependent manner
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IRC7 YFR055W
TCATAGGTATGCCGGCTCATTGTTTTCTATTTTAAAAAGTAAAAAATATGCTGCTAAAGG
AACACGTGAGAAATTACATTCTCCCTAGGTCTGCGATAACGCGGTAATATTACACTGCCG
CCGCCTTCCATGCCTTTGGAAAGCAGACAATGATGCTAGGCGGCGCCCAGCAGTATAAAC
TTTTCTTGCTTATAACCAGAACCTCTATCACAAAATTAGAAACTGCGATACTATGGGTCA
GATCGACACATAGGGAGCACTATTAGGCGCAAGGCGTATACATAGGCATTGCGTGTTCAA
AAATTGTCGTATGAGAAAAGTTCCAAACTTTCCACCATTACTCACCAACAACTTACACCA
GCCCGGATTTAAGATTTAGCTTCCGAGAATATTGTGACTCAGCCACTGGTCTCTTGAATG
TTGCGTGTAGCTTGATTAAGATTATGGCATAACCGTTTTTTTTACTTGGCAAGAGTGAAC
GTCCTTTTACTCCAAAAGGCTCCTGATGAAACTGGAGAGTCTCTTTGTTCTGAAATTTTT
AAAGTTTAGCACACCATATTCACGCTCGAGGTGAACCCAAGTTTTCCTGAAAAATGTGCC
ATGAACCTGAAAAAAAGAATTATTCTCGAAAATAAAAAAGGCAATCAAGATCGGAAAGAT
AAGCATTTTTTTTCAATCCGTATCTAACATTCATAAAGTGATAAAAAAATTGATAACGAT
TTTATTGTCGCCTCTTGTTTTGAGTATATTTTTTTAACGTTCTTTTTCGGCATTCAAATT
CCGTATAATCAACTCAATTGTAAGGCGCCGTAGCATCCAAATAATGTTGAAAGTGCCAAT
TTGCTCATCAGTGCTAAATATTCCTTGATAAAAATATAGAAGACAAGGACATATAAAAAG
AAAGACTGCTCTAGTGTTGGGACACCACAATGAAAAAATACTTAACGTGTTTCGAAACTG
TGAATATAAAATTCCAGCAAAAACCAAAATATTCACTACA
Chr coordinates Chr VI from 264204-265226
w3c xhtml validator w3c css validator