Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YGL007C-A
Systematic Name YGL007C-A
Strain S288c
Description Putative protein of unknown function, identified by gene-trapping, microarray-based expression analysis, and genome-wide homology searching; deletion exhibits slow-growth phenotype; computationally predicted to have a role in cell budding
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL007C-A YGL007C-A
TAAACGGGCGTATACATGCTTACCACACTCCCGTAAGCAAGAACAAAGAATTTATCTTGA
TAAACTGCGTAATAAGTCAATCAATTGCTCTATATACGCGCATATACGTAAAACACAGAA
TCACATTTTAGTCAGGCCCAAGCCGTATAGGGCGAAAAAGCCCGCGCTTATCAAGTCATC
GTAACGAATCAGATCTTTCCAACTGCTATCGCATACGTAAGAGAATTGAAATATTTCTCG
GGTACGATACGACATTTTTTCTTTACATTTCTTTACTAAACCCGACGGCACGGGAAAGAA
GATGAGACTCGGAACGGAAGCTAGAAGAAAAAGGAAGGACACAGAGATTTTCCGAGATTA
ACTCAGCTTTGCTAAAGTGCAAAAAGTCGTTTACGTCACCATCGCTGACGGGGAAAAAAC
AAAACAAGCTTCCTGAAACGGAGAAACATAAACAGGCATTGCTGGGATCACCCATACATC
ACTCTGTTTTGCCTGACCTTTTCCGGTAATTTGAAAACAAACCCGGTCTCGAAGCGGAGA
TCCGGCGATAATTACCGCAGAAATAAACCCATACACGAGACGTAGAACCAGCCGCACATG
GCCGGAGAAACTCCTGCGAGAATTTCGTAAACTCGCGCGCATTGCATCTGTATTTCCTAA
TGCGGCACTTCCAGGCCTCGAGACCTCTGACATGCTTTTGACAGGAATAGACATTTTCAG
AATGTTATCCATATGCCTTTCGGGTTTTTTTCCTTCCTTTTCCATCATGAAAAATCTCTC
GAGACCGTTTATCCATTGCTTTTTTGTTGTCTTTTTCCCTCGTTCACAGAAAGTCTGAAG
AAGCTATAGTAGAACTATGAGCTTTTTTTGTTTCTGTTTTCCTTTTTTTTTTTTTTACCT
CTGTGGAAATTGTTACTCTCACACTCTTTAGTTCGTTTGTTTGTTTTGTTTATTCCAATT
ATGACCGGTGACGAAACGTGGTCGATGGTGGGTACCGCTT
Chr coordinates Chr VII from 483027-482941
w3c xhtml validator w3c css validator