Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AGA2
Systematic Name YGL032C
Strain S288c
Description Adhesion subunit of a-agglutinin of a-cells, C-terminal sequence acts as a ligand for alpha-agglutinin (Sag1p) during agglutination, modified with O-linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>AGA2 YGL032C
ATGCAGTTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTAGCACAGGAA
CTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTG
TCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAA
TCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGCCCC
ATAAACACACAGTATGTTTTTTGA
Promoter Sequence
Download FASTA
>AGA2 YGL032C
CAAATCTGCCTCTTTGTTCAAGCAAAGAAAGAACCCAAGAAGAATCGCTTGGACTGTCTT
ATTCAGAAAGCATCACAAGAAGGGTATCACCGAAGAAGTTGCTAAGAAGAGATCTAGAAA
AACCGTTAAGGCCCAAAGACCAATTACCGGTGCTTCTTTGGACTTGATCAAGGAAAGAAG
ATCTTTGAAGCCAGAAGTTAGAAAGGCTAACAGAGAAGAAAAATTGAAGGCCAACAAAGA
AAAGAAGAAGGCTGAAAAGGCTGCTAGAAAGGCTGAAAAGGCTAAGTCTGCTGGTACTCA
AAGTTCTAAGTTCTCCAAGCAACAAGCTAAGGGTGCTTTCCAAAAGGTTGCTGCTACTTC
TCGTTAAGATTTATGCTCGAACTTATTATGTACAATGAATATTTTTCTTTTAAATCATTT
TTAAATATTTCAATTTAGTATTATTTTCTGTATAATTCATTCGCGAGGTATAATCTACCA
TCCACTTCTCTATCATTATACTCCCATATTTTTTTATTCACAGGCTAGACAATGGTAATG
GTGCTTTAGATGATTTCAGTGGATTACATTCGCACAATAGAATAAATGACTAATTTTCAA
GAATTTGTTTCAACCTGCCGGCATTCAGTTATTATAAGTTATTGTTTGATGGTAAAACTT
CGCCATCACCGGTTGCTGCGTTTATTGCAAAATTACTGAAACCATGTAATTTCCGAATAC
GGTAATTACACGCAGTTTGAAATTTGACATGCAAGTTTAACAAAAAAACTTCTGTCCGCA
TCTAAAGCTTAATTAAGGGACTGTTTCATACCTTCAGATCCAATATACTGAATATCAGGC
AATTGATTTCCCTTGTAAATATACAATATAAATAGTTGTAAGAAGAGGTGATATGTTAAG
TTTCCATTTTGACGTATTCCTCATTCTAGAATGATTGTAAGCTCTCAACAGTCACTTGTG
TGCCAAAATATTATACCTACTTCATACATTTTCAATTAAG
Chr coordinates Chr VII from 436833-436570
w3c xhtml validator w3c css validator