Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OLE1
Systematic Name YGL055W
Alias MDM2
Strain S288c
Description Delta(9) fatty acid desaturase, required for monounsaturated fatty acid synthesis and for normal distribution of mitochondria
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OLE1 YGL055W
CTTGCTGAAAAGATGATGTTCTGAGGTATTCGTATCGCTAGCTTGATACGCTTTTAACAA
AAGTAAGCTTTTCGTTTGCAGGTTTGGTTACTTTTCTGTACGAGATGATATCGCTAAGTT
TATAGTCATCTGTGAAATTTCTCAAAAACCTCATGGTTTCTCCATCACCCATTTTTCATT
TCATTTGCCGGGCGGAAAAAAAAAAGGAAAAAAAAAAAAAAAAAAAATAAATGACACATG
GAAATAAGTCAAGGATTAGCGGATATGTAGTTCCAGTCCGGGTTATACCATCACGTGATA
ATAAATCCAAATGAGAATGAGGGTGTCATATCTAATCATTATGCACGTCAAGATTCTCCG
TGACTATGGCTCTTTTCTGAAGCATTTTTCGGGCGCCCGGTGGCCAAAAACTAACTCCGA
GCCCGGGCATGTCCCGGGGTTAGCGGGCCCAACAAAGGCGCTTATCTGGTGGGCTTCCGT
AGAAGAAAAAAAGCTGTTGAGCGAGCTATTTCGGGTATCCCAGCCTTCTCTGCAGACCGC
CCCAGTTGGCTTGGCTCTGGTGCTGTTCGTTAGCATCACATCGCCTGTGACAGGCAGAGG
TAATAACGGCTTAAGGTTCTCTTCGCATAGTCGGCAGCTTTCTTTCGGACGTTGAACACT
CAACAAACCTTATCTAGTGCCCAACCAGGTGTGCTTCTACGAGTCTTGCTCACTCAGACA
CACCTATCCCTATTGTTACGGCTATGGGGATGGCACACAAAGGTGGAAATAATAGTAGTT
AACAATATATGCAGCAAATCATCGGCTCCTGGCTCATCGAGTCTTGCAAATCAGCATATA
CATATATATATGGGGGCAGATCTTGATTCATTTATTGTTCTATTTCCATCTTTCCTACTT
CTGTTTCCGTTTATATTTTGTATTACGTAGAATAGAACATCATAGTAATAGATAGTTGTG
GTGATCATATTATAAACAGCACTAAAACATTACAACAAAG
Chr coordinates Chr VII from 398628-400160
w3c xhtml validator w3c css validator