Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PYC1
Systematic Name YGL062W
Strain S288c
Description Pyruvate carboxylase isoform, cytoplasmic enzyme that converts pyruvate to oxaloacetate; highly similar to isoform Pyc2p but differentially regulated; mutations in the human homolog are associated with lactic acidosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PYC1 YGL062W
CTACGTGGGGCTATTGAGCGGTACCCTTAGCGGCTACTGCTTGTCGCCCTCGAAGCTGGA
CGCGTTTGAGGCAGCCATGCAGGAGTACGTGGGAACGCATAATTTTCACAACTTTACCAC
AGGAAAGCTTTGGGGGGATCCTAGTGCTCAGCGCCATATCAAAAAGGTTGTAGTGTCGCA
GGCCTCACCGGGATGGATATGTGTGCGGATCCACGGGCAGTCGTTTATGTTGCATCAGAT
TCGACGAATGGTAGCGCTTGCCGTACTTGCAGCCCGTTGCCAATTGCCGCCTAATATTGT
ACGTAACTATTTTAACGCCGGGCCTAGGAAATACATTCCGAGGGCGCCCGCACAAGGCCT
ATTATTAGAGGGACCTGTGTTTGACGGGTATAACACTAAGTTGCGCAATTTGCTGTATTG
CGAAATCCGCCCGGACGATATCACTCTTGAGCGCATGTGCCGTTTCCGAGAACGCCAGAT
CTGTACTGCGATCGCACACGAGGAGACACAGCGTCACGTGTTTTGCCATTTTGTACGACA
AATGAACCGCCTGGCCACGCCTCTAATCTAGCCGCCCAATGTCGCGGGTTGACCCGCGAC
ATTGGGCGGGCAATACTCTCATCTTATTGGCTATTCAACTTAGACAAGCGCCAGTTGCGC
GCACAAATTTGGTCATGACCGCTCCACCGGCATGCGTGTCGTCATCCCGCATCATTCGGG
ACATTTTGGCCTTTTCCGCAGTGCGTAGTTGACGTGGGGAGAAAGCTAGTGGGCTGTCGC
ATATGGTTGGTTTTAGGTGGCGAAAGTTTCGCCGCGATAGCAATCATGTCCTCGACCTTA
ATCTCAATGGAATGGGTCATGCTCGGTAAGTGAGTCTCGCTGTATATAAGTATATATGTA
ATCGCCTAGTTCGATAGATACAAGGAGGTCTTGAGTATGTAGATAAACGAAAAGAAGATA
ACAAAAGGAAAATCTCAGCCTCTCCCCTTCCTCTTAGACA
Chr coordinates Chr VII from 385196-388732
w3c xhtml validator w3c css validator