Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRH4
Systematic Name YGL064C
Strain S288c
Description Mitochondrial ATP-dependent RNA helicase of the DEAD-box family, plays an essential role in mitochondrial function
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>MRH4 YGL064C
ATGTCGCTTTTTTTCAAGCCAGTAATTTCACCACAGTGGTCTTTCCCCGTGCTTCTCAAG
ATAGGAGTGCGTTCTTATGCGGGAGGCCCAAGAACAAAGCATAAAGGAAACTCTCCATTA
GCTTCAGTGCCTACAGGCAGTAGTAATAAAAACCGAAAACAGAAGGCCAAAGGCAAAAAA
GGTAACAAAAAGAATGACCCTGACCAAGCATTCAACTTTGGAGAGTATGGTGGATTGAAA
AAAGACGTCGAGATGAATATGGACAGTACGAATAAACTCATTCAAAAAATATCGAATTTC
GACCAATTGCTTATACTTCCACCTGTCAGAGACGCTGTGAAAGAAATCATTTCCAAAGAG
TCCCTGAAGCTACAAGATAGTAGGAAAAAAACCAGTGAAAATATAATACCGAGTCCCATT
CAAACAGTGGCCATTAAGAGAATATCCAAAAATTTAATGGATCCAAAGTTACAAATACAT
GCGATTGCCGCTGAGACAGGTTCAGGTAAGACCATGGCCTACTTGATACCTTTAATAGAC
TATTTGAAAAGACAGGAGTTGGAAACTCCCGAATTATGGGAAACATTAAGAAAAAACGTT
CTGATTCGGTCCATCATACTGGTGCCTACGCATGAATTGGTTGACCAAGTATACGAAACT
GTTTCCAAGACGAAAACCTTGTTAGGCTTAAACTCTTTCAAGTGGGACAAGGCCACATCA
TATCGTGATTTATTAGAGAACATTAAAAATAGAATAGATATTTTAGTCACTACTCCGGGA
AAACTACTGAACCTGTTCTCCATAAGAATGATAACTAGACCTGATAAAGTCTTGTCCAAA
GTGGGTTTCGTAGTACTAGATGAAGCTGACACACTTCTAGATAGGTCATGGCTTGAAGAA
ACGCACTCCGCAATAAAGAGAATTCCTAACATTAATCACCTTATTTTCTGTTCCGCTACT
ATTCCTCAAGAGTTTAATAAAACAATGCAAAGACTATTTCCTACAGTGGTTCCTATAATG
ACACCCAGACTGCATAAGTTACCATTCGCTTTGGACTTTAAAGTTATAAATTCTGCCTTA
AGTCCTTTCAAGGGATCCAAGATCAAAGCATTGGCACAAACTTTATATGCTATTTCAAAT
GATGACACGGAACCAGGGTTCGAGAAAAGATGCATTATCTTTGTTAACGAAAAAAAGAAT
GTTCCTGAAATTGTTAACCTATTGAATAAGAAATTCGGTCATAATGCCATCGGTTTAACT
GGTGAAGATACATTTGAAGAAAGATCCGAGAAAATTATGCCCTTTTTATCACCACCGCGA
CCACTTTCGGAGGTGGTTGCTCAGAGTACTTCACCTCCCACTTCCTTGAAGAAATTTGAA
ATTCCTGATTCCAACATCGTCATCGGCAAATTGAAAAACACAAATTCTAATGGTACCGCA
CCCAGTAACAAGTCTTTGCATGTACTCGTAACCACCGACCTCATGGCAAGAGGGCTCAAT
TTCAAAGGTGTACGGAATGTTGTTCTCTACGATGTACCCAAAACGTCAATAGACCTGATA
CACCGAGTGGGCAGAACTGCTAGAATGAAACAGGGCGGCCGCGTATTTATGCTAACTGAC
AGTAAAACAAAATCTTGGGCTAAAGCTCTTCCAAAGATCATCAAAAAGCACCAGAGATTA
TCATGA
Promoter Sequence
Download FASTA
>MRH4 YGL064C
TAGCCCCACGTAGTCTTGTACCAAAGGATCGCTCTCGCTTAGTTTCTGTGCAGTGTCCTG
CAAACGGCACAGCTCATCCCCGCTAAATCTCCCACGCGTCTGTTCCAGGAACGTATCCCA
CACCTCTTGCGAGCCGTCTTCGCGGTAGCATCCCCCCACGTTTCGATGCAAAAGAGAACT
CCGGGGTGGACCAATGAGTATAAATTCTGGGATAAGGTATTGGTACCATCGAGAATCGCA
CGCGGATCTAGCATTAAACTTTTTATTGACAGGCTGGATACCCCACACGCGTATTTCGGG
CGGTAGTGCGGCGTTTAACTTCGCTACTGTGTCCTCTCGCAATGTGATCTTTAGCGACAG
TAGATTCAACATAGCGTGTACACCCTTGTCTGTTCTTGCCGCTGCCATAAAGGAATTTTT
CTTCGGTGCCAATGAATTTTCTTCGGAAATGGCTCCTACGTCGAAGAGCTTGGTGAGAAT
CTCACCTTCAATCGTCTTGTGTGGTGGGTTGTATTGCATTCCATAGTATCCGCTGCCACA
GTAACCTAAGAGCATAACGACCTTATGTTTACTCGGCCTTCTCTTTACTACCGCTGTTAA
CGGTGTCGGAGTAACCTCATCACTAGTACTACTACCATTTGTACTGAGCAGAACTGTTAA
TAAATGCTATGTTCACATCGATATATATACATATGTGTGTAAGGGGCTACAATTCATACA
TACGAGTATCTCTTTATTCTCTGGCCTGTAAATATTTGTCTTAAAACAGAGCTAGTCTTT
AATGCCGTCTTTTTCATTTTCTTTTCTCGATGGGTTCTATTTCGCAATACAACCGCTCTT
GCACAGCACAACCAAACCATATTCTTGAAATTTTCGAAAGGAAGCAAAAGTTCAAATCAC
TTACCACGGAATCATAAATTACAACTATAATAATAGCGGAATAGATATTAGTGATGAGTA
GAAATACTTCTTCAGATCAGATTAAAGTATAATAAGACAA
Chr coordinates Chr VII from 383208-381523
w3c xhtml validator w3c css validator